Чем отличается кислотный праймер от бескислотного: Что лучше: кислотный или бескислотный праймер, чем они отличаются

Чем отличается кислотный праймер от бескислотного: Что лучше: кислотный или бескислотный праймер, чем они отличаются

01.10.1989

Содержание

Кислотный и бескислотный праймер: отличия, применение, нюансы в работе обзор мастеров Cosmake.by

В работе мастера маникюра нет мелочей: для результата важен каждый этап. Праймер – материал, предназначенный для подготовки ногтевой пластины к наращиванию или нанесению покрытия. Он применяется сразу поле механической обработки и обеспечивает лучшую сцепку слоев. Существует две группы праймеров, отличающихся друг от друга составом.

Как работает праймер

Благодаря компонентам в составе средство вступает во взаимодействие с кератиновыми чешуйками: поднимает их, делает поверхность рыхлой, повышает адгезивные свойства. За счет этого обеспечивается стойкость покрытия. Некоторые праймеры придают дополнительную липкость и действуют как двусторонний скотч.

Преимущества

Использование праймера обусловлено следующими факторами:

·         деликатно подготавливает пластину к нанесению базы или материалов для моделирования;

·         снижает риск развития грибка и воспалительных процессов благодаря бактерицидным свойствам;

·         продлевает срок носки покрытия;

Кислотные праймеры

Материал предназначен в первую очередь для работы с ногтями, склонными к гидратации. Праймер подсушивает пластины, устраняя избыток влаги.

Предназначение

Этот материал предпочтителен и при наращивании ногтей – он обеспечивает сцепку с моделирующими материалами, имеющими больший вес по сравнению с гелевым лаком.

Применение

И все же мастеру следует помнить, что в составе средства раствор кислоты. Достаточно капли средства, чтобы получить эффект. Кислотный праймер наносится на ногтевую пластину предварительно отжатой кистью, тонким слоем. Контакта с кожей следует избегать, а при попадании средства на кутикулу или боковые валики нужно сразу удалить средство безворсовой салфеткой.

В полимеризации в УФ или ЛЛЭД-лампе большинство праймеров не нуждаются. Нужно просто дать подсохнуть ногтям 60-120 секунд естественным образом.

Бескислотные праймеры

Базовые покрытия премиум качества не нуждаются в применении кислотного праймера.

Несмотря на название, в большинстве современных материалов этой группы содержится кислота. Но по сравнению с кислотными препаратами ее содержание минимальное. Кроме того, в состав входит этилен и различные типы растворителей. Поэтому в работе нужна та же деликатность.

Назначение

Бескислотные праймеры обычно используют для работы с истонченными, ослабленными и хрупкими ногтевыми пластинами, которым могут навредить более агрессивные аналоги. Цель использования та же – обеспечение сцепки слоев.

Лайфхак с бескислотным праймером

Очень выручает этот материал при работе со слайдерами. Тонкой кистью нужно нанести праймер на мнущиеся края пленки, уже выложенной на ноготь, и он их сгладит. После картинку следует перекрыть базой или топом. Кислотный праймер может растворить узор или повлиять на цвет покрытия, его для этих целей лучше не применять.

Отличия и особенности

У кислотного праймера более выраженный эффект. В то же время использовать его без обоснованной необходимости нет смысла. Мастеру целесообразно иметь в арсенале средства обоих видов и выбирать то, которое подходит конкретным рукам. Домашним пользователям, выполняющим маникюр только себе и не делающим наращивание, можно ограничиться одним бескислотным.

При работе с кислотной группой в помещении желательно обеспечить циркуляцию воздуха. Пары имеют уксусный запах и вызывают неприятные ощущения. На ногтевой пластине кислотный праймер оставляет белесый след – этого не следует опасаться. Бескислотные материалы прозрачны, однако это может сбить с толку неопытного мастера: не стоит их наносить повторно, если не осталось следов использования.

Хранение

В особых условиях праймеры не нуждаются. Средство может быть упаковано в прозрачный или затемненный флакон из стекла, поскольку света, в отличие от полимеризующихся гелевых материалов, оно не боится. Однако выставлять его под прямые солнечные лучи не стоит. Желательно хранить праймер в прохладном помещении вдали от окна.

Работаем без лифтинга и вреда натуральным ногтям

Анастасия Лукша
• арт-директор студии Nail Couture,
• инструктор компании «Три Стар»,
• сертифицированный преподаватель брендов Entity, NSI, Supernail, EF exclusive

Что в первую очередь определяет качество выполненного наращивания?
• внешний вид.
• то, насколько долго этот внешний вид сохранится.
Но даже если сделать ногти с изысканным дизайном, ровной линией улыбки и красивой архитектурой, и на таких ногтях пойдут отслойки, клиентам это не понравится.
Если они появились, при каждой коррекции их приходится убирать, тем самым тратить немало сил, времени и материала. А клиенты разочаровываются в наращенных ногтях. Но если вы поймете, каким образом происходит сцепление натурального ногтя с материалом, вы легко разберетесь в причинах возникновения отслоек. И соответственно, научитесь работать так, чтобы они не появлялись. В итоге можно будет работать быстрее и проще, клиенты останутся довольны и, самое главное – вы станете больше зарабатывать!
Итак, разберемся в том, что же может послужить причиной отслоения материала.
Адгезия (от лат. adhaesio — прилипание) – сцепление поверхностей разнородных твердых и/или жидких тел. Чтобы понять сам процесс адгезии, сначала определим, что такое тела. Тела могут быть как твердыми, так и жидкими. И те, и другие состоят из молекул. Когда два тела соединяются между собой, это происходит за счет соединения молекул, которые находятся на их поверхности. Говоря простыми словами, если молекулы двух поверхностей подходят друг другу, они соединяются, аналогично фрагментам мозаики.
Обязательное условие соединения двух поверхностей – их совместимость
(рис. 1).

Например, когда мы рисуем краской на бумаге, они легко соединяются, потому что их поверхности совместимы. Другой пример – тефлоновое покрытие сковородки и растительное масло, которые служат для того, чтобы еда не прилипала к поверхности. Таким образом, существуют вещества, делающие поверхность различных тел несовместимыми для сцепления.
Еще один пример это восковое покрытие для автомобиля. Воск в данном случае служит как защитное покрытие.
Вода, грязь теперь не будут прилипать к ней. Сухие и чистые поверхности намного лучше сцепляются между собой. Чистая поверхность твердого тела позволяет молекулам жидкой субстанции подобраться ближе, обеспечивая лучшее сцепление.
Тонкий слой между сцепляемыми поверхностями называется связывающим веществом (рис. 2).

Пока оно целое, две поверхности плотно соединены между собой. Как только эта связь нарушается, происходит расслоение.
Правильная подготовка твердого тела, в нашем случае натуральной ногтевой пластины и правильное нанесение материала обеспечивает хорошее сцепление и исключает возникновение отслоек.

ПОДГОТОВКА НАТУРАЛЬНОГО НОГТЯ

1. Всегда обрабатывайте свои руки, а затем руки клиента антисептиком. Эта процедура немного напоминает обычное мытье рук, однако антисептик убивает некоторые бактерии на поверхности кожи, и слегка ее подсушивает, что очень важно, если к вам пришел клиент с влажными руками.
2. Далее удаляем лак или другое покрытие.
3. Следующий шаг – отодвигаем кутикулу пушером. Суть этой процедуры в том, чтобы отодвинуть ту часть кутикулы, которая уже начала нарастать на ноготь. Необходимо отодвинуть кутикулу не только сверху, но и вдоль боковых валиков. Очень часто, при отодвигании кутикулы, становится виден птеригий. Его также необходимо убрать. Если птеригия много, то убираем его сначала лопаточкой, а затем пилкой. Если мало, можно ограничиться только пилкой. Когда птеригий плотно прилегает к ногтю, он имеет прозрачный цвет, поэтому часто ошибочно его не полностью убирают, и это первая, одна из самых распространенных причин появления отслоек. Птеригий необходимо удалять полностью, потому что материал способен сцепляться лишь с натуральным ногтем, а не с тканями.
4. Далее, необходимо снять блеск с натурального ногтя. Если посмотреть на натуральный ноготь под микроскопом, то вы увидите, что он состоит из сотни микро-чашуек (рис. 3).

Так вот, при снятии блеска, мы убираем лишь от трех до пяти поверхностных слоев. Тех, на которых еще есть остатки грязи и масел. Поэтому при снятии блеска и вообще при работе с натуральным ногтем мы должны использовать пилку с абразивом 180 грит.
Существует миф, что чем больше спилишь натуральный ноготь, тем лучше будет сцепление с материалом. Это заблуждение. Даже наоборот. Использование грубых абразивов на натуральном ногте удалит около 20–30 слоев, а это уже 1/3 толщины всего ногтя. Таким образом, на поверхности будут уже глубинные слои ногтя, именно те, где происходит выработка влаги. Соответственно, материал на таких ногтях держаться не будет, т.к. поверхность их априори не будет сухой. В итоге мы получим отслойки.
А теперь, каким образом следует снимать блеск. Пилкой нужно работать по направлению роста ногтя, т.е. от кутикулы к свободному краю. Почему? Если снова взглянуть на ноготь под микроскопом, то мы увидим, что он состоит из большого количества мельчайших чешуек. Аналогично чешуйкам на рыбе. Они расположены краешками к кутикуле. Соответственно, чтобы улучшить сцепление, необходимо эти чешуйки приподнять, поэтому движения пилки будут преимущественно направлены к свободному краю (рис. 4).

5. Наносим дегидратор. Как мы уже говорили, сцепление двух тел всегда улучшается, если по-верхность твердого тела сухая и чистая. Дегидратор как раз выполняет эту функцию – удаляет с поверхности натуральной ногтевой пластины мелкие остатки грязи и влаги.
6. Наносим праймер.
Что такое адгезивы или адгезивные вещества?
Это химическое вещество, которое способствует сцеплению двух тел. В ногтевой пластине также присутствуют адгезивные вещества, которые соединяют клетки вместе. Обычно адгезивы имеют жидкую или гелеобразную консистенцию. Самый простой пример адгезива – клейкая лента. На нее нанесен тонкий слой адгезивного вещества, чтобы она могла прилипать к различным поверхностям. Без него сама по себе лента клеиться не будет. По такому же принципу работает и двухсторонний скотч, соединяется с двух сторон с двумя телами, в свою очередь, соединяя их между собой.
В зависимости от целей применяются разные типы адгезивов. Как мы знаем, клеи для бумаги, дерева, керамики, стекла и пластика отличаются друг от друга. Если адгезив разработан так, что он подходит как для склеивания дерева, так и для стекла, он также может применяться для склеивания их между собой. Так и для склеивания двух предметов из дерева и двух предметов из стекла. Однако приклеить к дереву металлический предмет уже не получится. Таким образом, вы видите, насколько важен правильный подбор и грамотное использование профессиональных материалов для работы.
Материал, которым мы моделируем ногти – гель или акрил, изначально до полимеризации (отвердевание) имеет гелеобразную консистенцию. Неслож- но догадаться, что если мы попробуем соединить с натуральным ногтем уже отвердевший акрил, то ничего хорошего не выйдет.
Что же помогает твердому телу сцепляться с жидкой субстанцией?
Праймер – вещество, которое подготавливает поверхность твердого тела, в данном случае натурального ногтя, к лучшему сцеплению с жидким телом.
Существует 3 типа праймеров: кислотный, полускислотный и бескислотный.
Кислотные праймеры содержат от 30 до 100% метакриловой кислоты.
При работе с кислотным праймером следите, чтобы во время коррекции он не попадал на материал, например, на типс. Также не следует допускать попадания праймера на кожу, т.к. это может вызвать химический ожог.

ПРИНЦИП РАБОТЫ КИСЛОТНОГО ПРАЙМЕРА (РИС. 5)

Условные чешуйки натурального ногтя уже приподнялись после снятия блеска и нанесения дегидратора. Кислотный праймер также удаляет влагу и грязь с поверхности натуральной ногтевой пластины, поднимая чешуйки еще выше (на схеме это помечено красным цветом). Таким образом, они лучше соединяются с материалом.
Полукислотные праймеры также содержат производные метакриловой кислоты. Тем не менее, не следует допускать его контакта с кожей.
Бескислотные праймеры не содержат кислоты (их активные компоненты изопропилидендифинил, бизоксигидроксипропил, гидроксиэтилметакри- лат), и не вызывают пожелтения материала при попадании на него.

ПРИНЦИП РАБОТЫ БЕСКИСЛОТНОГО ПРАЙМЕРА (РИС. 6)

Первый этап – аналогично предыдущей схеме, чешуйки натурального ногтя приподнялись после снятия блеска и обработки дегидратором. Далее, бескислотный праймер заполняет вязким веще- ством промежутки между чешуйками, и в свою очередь создает дополнительную связь на поверхности, которая в дальнейшем соединится с материалом. Т.е. он работает по принципу двухстороннего скотча.
При правильной подготовке ногтя применение любого типа праймеров обеспечит идеальное сцепление мате- риала и натуральной ногтевой пластины.
7. Далее идет этап моделирования.
Еще одна из причин возможного возникновения отслоения материала – сильные механические удары. Вероятность возникновения отслоек от удара увеличивается в несколько раз, если своевременно не производится коррекция ногтей.
При отрастании вся архитектура ногтя постепенно смещается ниже. Таким образом, получается рычаг, свободный край становится тяжелее обычного и начинает перевешивать, увеличивая вероятность слома или отслойки. Понимание принципов строения и подготовки натурального ногтя, функций материалов, которыми вы работаете, очень важно для профессионала ногтевого сервиса. Зная все эти принципы, вы не только сможете ответить на любой вопрос клиента, но и не допустите ошибок при работе. А если они и возникнут, то всегда сможете их проанализировать и не допустить дальнейшего возникновения проблем. А это, безусловно, повысит ваш профессионализм и, конечно же, заработок!

Курсы маникюра и наращивания ногтей для начинающих со скидкой 50%!!! Успейте записаться!!!
Вы хотите обрести независимость?
Научиться профессионально наращивать ногти?
Самостоятельно распоряжаться свои рабочим графиком?
Мы готовы помочь Вам в этом:
• Обучение в маленьких группах. До 8-ми человек на базовых курсах и до12-ти на курсах повышения квалификации.
• 40 академических часов теории и более 100 часов практики – мы заботимся о качестве нашего образования.
• Мы предлагаем более 20-ти видов различных программ обучения.

На наших курсах Вы научитесь не только как правильно моделировать
ногти, но и как начать работать – составить прайс-лист, как создать
клиентскую базу, психологии общения с клиентом, как выходить из сложных
ситуаций и многое другое.
• Индивидуальный подход к каждому студенту.
В связи с малым количеством человек в группе преподаватель имеет
возможность индивидуально подстраивать программу обучения под каждого
слушателя.
• Диплом, который Вы получите по окончании курсов дает право работать в более, чем 14-ти странах мира.
• Наши преподаватели имеют богатый опыт преподавания, являются призерами и лауреатами Российских и Международных конкурсов.
• После завершения обучения Вы всегда можете обращаться к нам с любыми вопросами, проблемами предложениями.
Курсы:


Курс маникюра 4 дня
Даты: 11-14 марта


Базовый курс по моделированию ногтей акрилом
Даты: 18 марта — 12 апреля


Базовый курс по моделированию гелем
Даты: 2 апреля — 17 апреля


Общий курс основы маникюра акрил гель
Даты: 18 марта — 12 апреля

Праймер бескислотный и кислотный


Какой праймер лучше кислотный или бескислотный для гель лака * В чем разница

Процедура маникюра и нанесения гель-лака сегодня довольно популярная, именно поэтому стоит подробно ознакомиться со средствами, которые используются в процессе работы. Мастера отдают предпочтение кислотным и бескислотным праймерам, которые подготавливают ногтевую пластину к работе. В результате этого возникает вопрос, какой праймер для гель-лака лучше: кислотный или бескислотный? В статье мы расскажем обо всех особенностях данных средств, а также ответим на часто интересующиеся вопросы.

Что такое бескислотный праймер?

Бескислотный праймер – это средство для обезжиривания ногтевой пластины, которое еще и используется с целью увеличить сцепляемость ногтя и материала. Благодаря такому средству конечный результат сохраняется на более длительное время, целостность покрытия не искажается даже при длительном ношении.

Существует множество преимуществ бескислотного праймера, отметим:

  • Ногтевая пластина не поддается негативному воздействию, даже при длительном хождении;
  • Можно предотвратить появление отслаивания ногтевой пластины;
  • Очень удобное и доступное средство для применения;
  • Долговечность.

Интересно! Именно бескислотный праймер не разрушает ногтевую пластину, зато глубоко обезжиривает, позволяя гель-лаку идеально ровно ложиться на поверхность и закрепляться на длительное время.

В составе бескислотного праймера содержатся полезные и безопасные компоненты, именно поэтому ему отдают предпочтение многие.

Сфера применения бескислотного праймера

Бескислотный праймер используется преимущественно на момент покрытия ногтей гель-лаком или во время наращивания. Именно он подготавливает ногтевую пластину к грубому воздействию базового покрытия, а также к нанесению самого средства.

Специалисты не рекомендуют использовать праймер для создания домашнего маникюра, не используя гель лак или гель для наращивания. Для обычного лака действие праймера не будет видно на все 100%, ногти по-прежнему могут быть ломкими, не гарантируя цепкую связь ногтевой пластины и лака.

Что такое кислотный праймер?

Кислотный праймер – это средство для укрепления ногтей, в составе которого содержится небольшое количество метакриловой кислоты. Это довольно токсичные и ядовитые вещества, которые сильно подсушивают ноготь, позволяя происходить хорошему сцеплению ногтя и геля.

Важно! Использование кислотного праймера уместно только в случае присутствия излишне жирной ногтевой пластины. Девушкам с сухой поверхностью его применение противопоказано, это может привести к излишней сухости.

Многие интересуются вопросом, как отличить кислотный праймер от бескислотного? Здесь только один ответ: нужно подробно ознакомиться с предоставленной инструкцией, а также составов. Если стоит цель выбрать кислотный праймер, в его составе обязательно должна присутствовать кислота, которая и будет обеспечивать полноценное просушивание ногтевой пластины.

Для чего применяется праймер на кислоте?

Разница между кислотным и бескислотным праймером очевидна, и ответ можно увидеть в самом названии средства. Но, в чем же заключается отличие кислотного праймера от бескислотного, и как от этого зависит сфера применения?

Как уже было описано выше, кислотные праймеры уместно использовать только девушкам, чья ногтевая пластина характеризуется повышенной жирностью, которая противостоит цепкому сцеплению гель-лака и ногтя. Эффект мгновенного подсушивания виден на лицо, потому что за считанные секунды ногтевая пластина покрывается так называемой пленкой, которая гарантирует сухость и безопасность для ногтя во время воздействия компонентов гель-лака или геля для наращивания.

Чем отличается кислотный праймер от бескислотного?

Узнав о том, что существует две разновидности праймеров, у многих возникает вопрос: чем отличается кислотный праймер от бескислотного, и какой вариант лучше всего использовать в процессе работы? Самым первым отличием является состав средств, а именно, присутствие или отсутствие кислоты, которая отвечает за дополнительное мгновенное подсушивание ногтевой пластины.

Помимо этого, можно отметить и другие отличия кислотного праймера от бескислотного:

  • Кислотное средство рекомендуется для использования только тем девушкам, которые имеют повышенно жирную ногтевую пластину;
  • Кислотный праймер обеспечивает прочное сцепление материала и ногтя, в результате чего гель-лак носится намного дольше;
  • Кислотный праймер наносится преимуществен под акриловые ногти, а вот бескислотный праймер используется для гелевого наращивания;
  • Бескислотный праймер – это универсальное средство, оно подходит под любую ногтевую пластину, рекомендовано даже девушкам со слабыми и слоенными ногтями, чего не скажешь про кислотный праймер. Его предназначение – исключительно повышенная жирность ногтей;
  • Бескислотный праймер оказывает воздействие на поверхность только после использования базового цветового покрытия, не является эффективным в чистом виде.

Еще один простой способ определить, какое средство используется в процессе маникюра: кислотный праймер после высыхания оставляет после себя заметно белый оттенок, а после использования бескислотного средства такого не наблюдается.

Какой праймер лучше: кислотный или бескислотный?

В силу своих особенностей, кислотный и бескислотный праймер пользуются популярностью. У одного средства она больше, у другого меньше. За счет этого многие интересуются, какой из вариантов лучше перед нанесением гель лаков, и какому варианту стоит отдавать предпочтение.

Выбор будет зависеть непосредственно от цели, именно поэтому стоит рассмотреть особенности двух вариантов более подробно.

Кислотный праймер:

  • Используется для работы с поврежденными и ломкиси ногтями;
  • Применяется перед нанесением шеллака, геля, акрила;
  • В составе присутствует метакриловая кислота;
  • Иногда могут возникать негативные реакции ногтевой пластины, именно поэтому требует тонкого нанесения на ноготь;
  • Характеризуется едким запахом, поэтому при использовании нужно надевать специальные маски на лицо.

Бескислотный праймер:

  • Подходит для использования перед нанесением гель-лака, шеллака или наращивания;
  • Также как и кислотный, используется при поврежденных ногтях, обеспечивает им плотность после нанесения;
  • В составе нет кислот, присутствует только этилацетат;
  • Быстро сохнет, имеет неприятный запах;
  • Является щадящим для любого типа ногтей.

В большинстве случаев специалисты отдают предпочтение именно бескислотному праймеру, потому что он справляется со всеми нужными задачами, а также идеально подходит для каждой девушки, не вызывает аллергические проявления.

Как правильно наносить праймер?

Чтобы праймер для маникюра давал желаемые результаты, полноценно укреплял ногти и обеспечивал им защиту, необходимо ознакомиться с особенностями его использования. Для кислотного и бескислотного средства существуют свои правила нанесения, именно поэтому с ними нужно более подробно ознакомиться в начале манипуляции.

Кислотный праймер

Отличия кислотного и бескислотного праймера уже выяснили, они имеются не только в характере воздействия и в составе, но еще и в способах нанесения на поверхность ногтевой пластины.

Нужно помнить! В составе присутствует токсическая кислота, но она не воздействует негативным образом на ноготь, если соблюдать все правила использования.

Сначала необходимо подготовить ногти, предварительно делается маникюр со всеми процедурами, потому что после нанесения средства любые манипуляции пилочкой или щипчиками запрещены.

На кисточку нужно набрать немного средства и прикоснуться им к середине ногтя, чтобы праймер равномерно распространился по всем уголкам. Не стоит брать излишние количество жидкости, которая будет вытекать за пределы кутикулы и только создавать неудобства в использовании. Если взять небольшое количество средство, оно примет нужную форму и позволит сразу же сушить его.

Праймер хорошо сушится под воздействием окружающего тепла и воздуха, поэтому достаточно 30-40 секунд, и можно переходить к следующему этапу – нанесению базового покрытия, которое сушится в лампе.

Бескислотный праймер

Технология использования бескислотного праймера практически не имеет различий, для начала необходимо подготовить ногти к нанесению средства. Бескислотный праймер все считают щадящим средством, именно поэтому с ним возникает много проблем во время использования. Несмотря на то, что в составе нет кислоты, при чрезмерном количестве он может нанести вред ногтевой пластине, пересушить ее. Именно поэтому нужно взять средство на край кисточки, и этим минимальным количеством стараться укрыть все 5 пальцев руки.

После себя праймер не оставляет никаких следов, именно поэтому ногти за несколько секунд принимают свой изначальный вид, и считаются готовыми для нанесения базового покрытия.

Тонкости при работе с кислотным и бескислотным праймером

Каждый праймер для ногтей имеет свои тонкости в работе, с которыми нужно предварительно ознакомиться.

Оба средства – это токсические вещества, которые присутствуют в составе в большем или в меньшем количестве. Именно поэтому нужно знать о следующих важных моментах работы с ними:

  • Мастер обязательно проводит работу в перчатках;
  • Нельзя вдыхать запах праймера, лучше воспользоваться специальной маской;
  • Наносятся средства в минимальном количестве и тщательно распространяются по всей области ногтя;
  • Сушить их не нужно, они и без лампы высыхают максимально быстро.

Эти тонкости позволят провести работу быстро, качественно и результативно.

Важно! Если имеются индивидуальные аллергические проявления на праймер, его использование стоит заменить другими народными средствами.

Ответы на вопросы мастера маникюра

У каждой женщины возникает масса вопросов при начале работы с кислотным или бескислотным праймером. Чтобы получить ответы на все вопросы, ознакомьтесь ниже с ответами специалиста, который знает все тонкости и особенности работы с данными средствами, а также может похвастаться большим опытом в данном деле.

Как отличить кислотный праймер от бескислотного?

На самом деле кислотный и бескислотный праймер – это два разных средствах, отличия которых видно невооруженным взглядом. В первую очередь нужно ознакомиться с его составом, и если в нем присутствует слово «кислота», это 100% только кислотный праймер. Также у них имеется разных запах. К примеру, за счет содержания кислоты, кислотный праймер характеризуется более резким запахом, перенести который без маски удается не всем. Это основное определение, которое можно заметить еще до его использования.

Если же вы пришли на процедуру к мастеру, и хотите узнать, какой вариант средства используется, следите за состоянием ногтей после нанесения праймера. Если он кислотный, то за считанные секунды ноготки образуют белый цвет, который говорит о том, что произошел полноценный процесс подсушивания ногтевой пластины. О разнице кислотного и бескислотного праймеров смотрите в видео:

Что общего между кислотным и бескислотным праймером?

Кислотный праймер, точно также, как и бескислотный, имеют свои особенности, преимущества, недостатки, и схожести. Давайте разберем, что между ними общего и отличительного. Пример в таблице.

Общие качестваОтличия
Наносятся на ногти для цепкости ногтевой пластины и материла.Состав
Имеют резко неприятный запах.Стоимость
Не требуют сушить их в лампе.Цвет ногтей после нанесения
Наносится на ногти легким слоем.Категория женщин для использования.
Не вызывает аллергии.Уровень воздействия на ногти.
Нужен ли праймер под обычный лак для ногтей?

Многие действительно используют праймер и для обычного лака, и он дает неплохие результаты. После нанесения средства ногти становятся более плотными, не подвергаются ломкости, сохраняют сам лак на несколько дней дольше, нежели без его использования. Но в большинстве случаев праймер является необходимым именно для гель-лака.

Можно ли наносить гель лак без праймера?

Если не использовать праймер для гель лака, эффект будет несколько другой. Длительность целостности геля будет минимальным, ногти могут поддаваться ломкости, сколам, ударам. Гель лак требует использование праймера для большей плотности и целостности ногтей, именно поэтому о его наличии нужно позаботиться заранее.

Вывод

Кислотный и бескислотный праймер – это два разных средства, но они оба являются основной под гель лак и требуют использования одного из вариантов. Каким он будет, зависит от цели, а также от особенностей ногтевой пластины.

faceandcare.ru

Праймер кислотный и бескислотный: в чем разница, какой лучше

Праймеры – это обязательное средство, которое выполняет при подготовке ногтей к наращиванию определенные функции: обезжиривает, очищает, обеззараживает и в будущем обеспечивает крепкую сцепку искусственного материала с пластиной. Такое воздействие позволяет сделать наращенный ноготь крепким и предотвратить сколы. Но как выбрать конкретное средство, которое будет наиболее эффективным. Также вас сможет заинтересовать информация о том, нужен ли праймер под шеллак и как его использовать.

В чем отличие

Существует два типа праймера для ногтей – кислотные и бескислотные. Они отличаются по составу, эффективности действия и результатам. Также может отличаться и сфера их применения, сочетаемость с тем или иным искусственным средством.

Кислотные праймеры

Кислотные праймеры имеют свойство агрессивно обезжиривать ногти, воздействуя при этом на структуру. Они на 80% состоят из метакриловой кислоты. Соответственно при неправильном использоваии способны нанести существенный ущерб как ногтю, так и коже вокруг него.

При использовании в домашних условиях часто можно встретить отзывы пользователей, где говорится о получении химического ожога кожи и нарушении структуры пластины. Но несмотря на все это, нельзя сказать, что они плохие. На самом деле они достаточно эффективные, если используются профессионалами. Поэтому спектр их применения – салоны, кабинеты, где исполняют маникюр профессионально.

Важно понимать, что кислотные праймеры основаны на токсичном веществе, которое применяется только при акриловом наращивании. Строго говоря, это единственный косметический препарат, который позволяет качественно провести данную процедуру и получить в результате красивые ногти на долгий промежуток времени.

В процессе воздействия состава на ноготь поднимаются чешуйки верхнего слоя пластины. Учитывая параллельное их подсушивание, осуществляется крепкая сцепка кератинового слоя с искусственным материалом.

Также вас сможет заинтересовать информация о том, как использовать праймер для гель лака.

Поэтому такое средство будет максимально эффективно и безопасно для девушек, у которых жирная ногтевая пластина с чрезмерным глянцем, влажные руки. Если же ноготь тонкий и ломкий, то лучше использовать более щадящий аналог.

Бескислотный праймер

Бескислотные праймеры считаются более безопасными для здоровья ногтей и кожи средствами. Собственно говоря, именно поэтому их и стали применять в домашних условиях при нанесении гель-лака, шеллака или биогеля. В его составе нет кислот (поэтому ищите упаковку с пометкой «non acid»), хотя в низкокачественных средствах может присутствовать метакриловая кислота в минимальном объеме.

Качественные средства идеально подходят для тонких, склонных к расслаиванию и ломкости ногтей. У него щадящее действие на кератиновый слой. Такой состав призван:

  • Обезжирить пластину;
  • Устранить загрязнения и микроорганизмы;
  • Подготовить ноготь к нанесению гелевых препаратов.

Причем выполняться все это должно без изменения уровня рН пластины. Поэтому его хорошо применять для биогеля и шеллака, но нельзя – для акрила. Еще один плюс такого средства – подсыхание состава на ногте без применения лампы.

Бескислотный праймер чаще всего применяется между дегидратором и основой. Дегидратор устранит избыток влаги в ногте, праймер обезжирит и подготовит «почву», а основа на такой поверхности закрепится более плотно.

А вот какой праймер нужен для гель лака и как его правильно подобрать, изложено здесь.

Как отличаются бескислотный и кислотный праймеры?

Рассмотрев оба вида, можно сказать, что в целом у них практически одна направленность и действие. Но и отличий при этом масса в действии:

  • Кислотный состав более агрессивный, а потому способен травмировать кожу и ноготь при неаккуратном и неправильном пользовании. Бескислотный же не вызывает такого разъедающего эффекта в короткие сроки. При попадании на кожу достаточно помыть задетую область с мылом.
  • Кислотный праймер используется для акрила, бескислотный – для всех остальных типов наращивания ногтей.
  • Первый оказывает более мощный сцепляющий эффект, а второй считается более щадящим и потому пусть и не намного, но менее эффективным в данном контексте.
  • Есть мнение, что частое пользование кислотным средством может существенно повлиять на структуру ногтя, вызывая со временем слоение и шелушение. У бескислотного этот эффект достигается за гораздо большие сроки.
  • Бескислотный больше подходит обладательницам тонкой ногтевой пластины, склонной к расслоению, а также сухой и чувствительной кожи. у женщин с глянцевыми жирными ногтями и потеющими руками кислотный состав будет более актуален.
  • Кислотный существенно меняет рН, причем на долгое время. А вот его аналог практически не воздействует на данный показатель или воздействует только на время нанесения в первые полчаса-час, если верить исследованиям косметологов.
  • Бескислотный праймер достаточно быстро высыхает – примерно около минуты, в то время как кислотный сушится до 4 минут.

А вот как наносится и правильно используется основа под макияж праймер, можно увидеть здесь.

На видео – в чем разница между кислотным и бескислотным праймером:

Это основные отличия, если говорить о воздействии средств. Но все же главное отличие заключено именно в составе, который в первом случае имеет кислоту, а во втором более щадящие компоненты.

Несмотря на все отличия, важно понимать, что оба типа средства наносятся очень тонким слоем, не затрагивая кожи и кутикулы. И до того, как приступить к нанесению основы, нужно дождаться полного высыхания состава на ногте.

А вот какой существует лучший бескислотный праймер и как его правильно подобрать и использовать, указано здесь.

Стоит понимать, что такие средства могут быть сухого типа, то есть при высыхании дают обезжиренный шероховатый поверхностный слой. Также они могут быть липкого типа, придавая поверхности ногтя повышенные скрепляющие свойства. Кроме этого некоторые женщины сталкивались с тем, что праймер не подходил к основе, так как не давал должных скрепляющих эффектов в отношении конкретного средства. Поэтому стоит подбирать средства либо на основе отзывов, либо по бренду. Производители чаще всего создают те или иные средства в качестве компонентов одной линейки.

Возможно вас также сможет заинтересовать информация о том, как применяется омбре на короткие ногти гель лаком.

Что лучше

Говорить о том, какой именно тип средства лучше, сложно, ведь во многом показатели зависят именно от того, под какую основу приобретается состав праймера. Для акрила наилучшим будет кислотный, так как именно он обепечит наибольшую сцепку естественного и искусственного слоев. Но при этом использовать такое средство могут только мастера и только в условиях салона.

Бескислотный будет актуален как для салонного пользования, так и для домашнего, но только при условии применения под гель или шеллак (а вот чем отличается покрытие гель лаком от шеллака, можно посмотреть здесь). Для акрила он категорически не подходит, так как не дает должного скрепляющего эффекта для этого материала. Он более безопасен в применении и не оказывает такого агрессивного действия на кератиновый слой пластины, как кислотный вариант.

soinpeau.ru

Кислотный праймер, какой лучше * Кислотный или бескислотный

Для качественного маникюра придумана особая технология, основой которой является бескислотный или кислотный праймер, выполняющий очищающую и защитную функцию. Это жидкость, расфасованная в бутылочки с кисточкой для удобного нанесения. Активные вещества в её составе обезжиривают пластину,уничтожают микробы и обеспечивают максимальное сцепление материалов, применяющихся для окрашивания ногтей. Чтобы разобраться, какое средство оптимально подходит для работы, важно выяснить его отличительные черты и принцип действия.

Особенности праймеров

Праймер подготавливает основу для нанесения декоративных средств и защищает ноготь от химических компонентов искусственного покрытия. Жидкость тщательно дезинфицирует и сушит пластину. Она работает как клейкая лента, надёжно удерживая покрытие, не давая ему отойти по краям.

Профессиональные мастера используют кислотные и бескислотные праймеры, которые отличаются составом и действием. И те и другие устраняют грязь, растворяют жир, впитывают влагу, способствующую развитию патогенных микроорганизмов, делают поверхность шершавой и готовой к нанесению цветного покрытия.

Кислотный

Продукция изготовлена на основе метакриловой кислоты. Это агрессивный токсин, который глубоко обезжиривает ногти и приподнимает чешуйчатые пластинки, делая сцепление с гелем максимально крепким.

  1. Метакриловая кислота не накапливается в организме, но вдыхать её пары опасно для здоровья.
  2. Чтобы избежать негативных последствий, такой маникюр делают в хорошо проветриваемом помещении.
  3. На лицо надевают защитную маску, а на руки латексные перчатки.

В составе концентрация кислоты низкая, поэтому при правильном применении онне вызывает ожогов. Сильные подсушивающие свойства делают жидкость востребованной для девушек с плотными ногтями. Если пластина иссушенная, склонная к ломкости, кислота ухудшит её состояние.

Бескислотный

Безопасность для ногтевой структуры— главная черта бескислотного праймера и основное отличие от кислотного. Такие средства подходят для салонного и домашнего применения, чтобы:

  • Обезжирить пластинки;
  • Продезинфицировать;
  • Подготовить к нанесению геля.

Воздействие состава не влияет отрицательно на кератиновый слой и не изменяет уровень рН. В нём содержится этилацитат — безвредный химический растворитель, не провоцирующий расслоение пластины.Благодаря этому средство подходит для девушек с проблемными иссушенными ноготками.

В чём их отличие?

Выбирая кислотный или бескислотный праймер, нужно понимать, для какой цели лучше подходит та или иная продукция. Сравнительную характеристику можно изучить в таблице.

РазличияКислотныйБескислотный
СоставМетакриловая кислота.Этилацитат.
СушкаБез лампы 4 минуты.Без лампы 1 минута.
ЗапахЕдкий ( для использования необходима маска).Не имеет запаха.
ДействиеПодсушивающие, агрессивное.Щадящее, не портящее пластину.
Где используетсяДля акриловой и гелевой технологии.Для шеллака,гелевого укрепления и наращивания.

Какой праймер лучше — кислотный или бескислотный?

Оба средства имеют общую направленность и предназначены для обезжиривания и устранения микробов. Они отличаются составом и мощностью действия.

  1. Кислотный праймер при попадании на кожу может спровоцировать лёгкий ожог и при регулярном применении изменяет структуру пластины, делает её более тонкой и уязвимой. Состав даёт сильный сцепляющий эффект, потому маникюр держится дольше.
  2. Бескислотный праймер не разъедает ногти, не вызывает шелушение и слоение пластины. Состав застывает в течение 1 минуты под воздействием воздуха.

Оба праймера требуют аккуратности при использовании. Наносите их тонким слоем, исключая попадание на кутикулу и кожу рук. Не забывайте, что нужно дождаться полного испарения жидкости, прежде, чем наносить основу.

Определить, какой праймер лучше, бескислотный или кислотный, сложно. Их эффективность зависит от того, для какой основы подбирается состав. Кислотные средства незаменимы для акрилового покрытия. Агрессивное воздействие осуществляет глубокое обезжиривание и сушку, которые обеспечивают хорошую сцепку декоративного и естественного слоя. Такую работу лучше доверить профессионалам и делать маникюр в хорошем салоне красоты.

Бескислотный состав — отличный вариант для подготовки ногтя к нанесению шеллака или геля. Для акрила он не актуален, так как не может гарантировать сцепление этого материала. Щадящее действие, отсутствие специфического запаха и лёгкость окрашивания позволяют применять его не только в салоне, но и дома.

В данном видео подробно описано как выбрать лучший праймер для маникюра:

Советы мастера по маникюру по выбору праймера для ногтей

Общие рекомендации для использования кислотного и бескислотного средства не отличаются друг от друга. Вначале отшлифуйте пластину машинкой или опилите пилкой. Количество жидкости для обработки зависит от стояния пластины. Праймер наносится очень тонко.

  1. Предварительно отожмите кисточку о флакончик, промокните о салфетку.
  2. Аккуратно смажьте центр пластины и подождите, пока средство растечётся по ногтю.
  3. Не допускайте попадания жидкости на кожный покров.
  4. Если неприятность произошла, сразу вытрите состав влажным спонжем, и промойте пальцы водой.
  5. После работы закройте флакон, выкиньте салфетку.
  6. Когда пластина полностью высохнет, нанесите базу.

Если кислотный праймер применяется на плотных ногтях, профессионалы советуют дождаться высыхания первого слоя и наложить второй.После испарения жидкости поверхность посветлеет. Это знак, что можно покрывать ноготки акрилом.

Мастера маникюра не дают однозначного ответа, какой праймер для ногтей лучше, бескислотный или кислотный. Оба средства хорошо выполняют свою функцию и готовят пластинки к декоративному окрашиванию. Последний они рекомендуют для гелевого и акрилового наращивания, потому что мощная схватывающая способность позволяет сохранить идеальное покрытие как можно дольше. Подсказки по выбору праймера смотрите в таблице.

Когда лучше выбрать кислотный праймерКогда лучше выбрать бескислотный праймер
Акриловое или гелевое наращивание.Гелевое наращивание, шеллак или окрашивание гель-лаком.
При нанесении гель-лака девушкам, у которых чрезмерно потеют ладони.Если ногтевая пластина пересушена, истончена или слоится.
Для обработки плотных, маслянистых ногтей.Когда хочется исключить агрессивное влияние на кератиновый слой.

Если средство нанести слишком обильно, оно может полностью пропитать пластину и повредить ногтевое ложе. Почувствовав сильное жжение во время работы, не медлите. Срочно смойте обезжиривающий состав водой. Его действие хорошо нейтрализует обычное мыло или пищевая сода.

Лучшие кислотные и бескислотные праймеры для ногтей

На полках косметических магазинов представлен широкий выбор средств, в многообразии которых несложно растеряться. Мастера маникюра рекомендуют популярных производителей, продукция которых хорошо себя зарекомендовала:

  • EzFlowPrimer;
  • Kodi professional Primer;
  • Parkway Professional «X-Cover Primer»;
  • IBD;
  • RuNail.

В линейке IBD хочется отдельно выделить праймер для акрила Primer. Профессиональное средство обеспечивает максимальное склеивание искусственного материала с естественной пластинкой и полностью исключает риск отслаивания. В составе высокий процент метакриловой кислоты, поэтому обязательно используйте маску и перчатки.

Доступной ценой и качеством отличается продукция LadyVictory. Компания производит бескислотные и кислотные праймеры, гарантирующие великолепную стойкость декоративному покрытию ногтей.

Специалисты предупреждают, что любой праймер требует усидчивости и аккуратности от мастера. Только качественная работа позволяет маникюру держаться долго и сохраняет здоровье ногтевой пластины.

faceandcare.ru

Бескислотный или кислотный праймер для ногтей: какой выбрать?

Праймер для ногтей необходим, если вы хотите сделать гелевый маникюр и шеллак. Какой лучше выбрать?

прочтение займет 1 минута

Текст: Редакция Makeup.ru 16 декабря 2016

© iStock

С латинского языка праймер переводится как «первый», поэтому легко догадаться, что это базовое средство наносят на подпиленные ногти при наращивании. Праймер обеспечивает надежное и крепкое сцепление материалов ногтевой пластины с искусственным покрытием.

Праймер защищает ногти от пожелтения, расслаивания ногтевой пластины, появления трещин, а также препятствует проникновению микроорганизмов, которые вызывают грибок. Чем отличаются разные виды праймеров?

Кислотный праймер

Кислотный праймер содержит небольшое количество метакриловой кислоты. Это токсичное вещество, которое применяется при акриловом наращивании. Он воздействует на поверхность ногтя: чешуйки приподнимаются и сцепляются с гелем. Благодаря этому процессу образуется прочная связь. Так как кислоты обладают подсушивающими свойствами, то такой праймер подойдет для девушек с жирной ногтевой пластиной. А тем, у кого она сухая и тонкая, лучше воспользоваться следующим вариантом.

 Бескислотный праймер

Бескислотный праймер – самый безопасный,  так как не содержит кислот. Поэтому он подойдет для чувствительных и тонких ногтей. В то же время он хорошо обезжиривает и не меняет уровень pH. Такой праймер отличается от кислотного тем, что его используют для шеллака и биолака, однако для акрилового покрытия он не подходит. Бескислотный праймер сохнет без ультрафиолетовой лампы.

  • Наносить праймер на ногти нужно после использования дегидратора и до нанесения базового покрытия.
  • Нанесите немного праймера на центр ногтя и далее распределите по всей ногтевой пластине.

А какой праймер подходит вам? Расскажите в комментариях. 

  • советы по маникюру
  • праймер для ногтей

makeup.ru

Что такое праймер для ногтей и как его использовать?

Праймер для ногтей используется перед гелевым маникюром, чтобы загрунтовать ноготь. Если вы хотите, чтобы базовое покрытие оставалось на ногтях, вам нужно счистить с них масло и жир. Праймеры для ногтей бывают разных форм. Некоторые из них бескислотные, а другие содержат кислоты. Самый популярный тип праймера для ногтей — бескислотный. С другой стороны, вы можете использовать праймеры для ногтей, чтобы создать крошечные трещины и трещины в ваших ногтевых пластинах, чтобы акриловые краски и лаки лучше держались , но никогда не пренебрегайте уходом за ногтями.Существует два типа грунтовок:
1. Кислотная грунтовка, 2. Бескислотная грунтовка.

Кислотный праймер для ногтей в сравнении с бескислотным праймером для ногтей

Кислотный праймер для ногтей

  • Кислотный праймер называется кислотным, потому что на 95% состоит из метакриловой кислоты .
  • Кислотный праймер высыхает на ногтевой пластине за 3-5 минут , в результате чего цвет становится беловатым.
  • При прямом контакте кислотного праймера с кожей в результате небрежного обращения он может вызвать раздражение и химические ожоги.
  • У них есть способность окрашивать улучшение в желтый цвет, если оно используется неправильно.
  • Важно соблюдать крайнюю осторожность при использовании кислотных грунтовок.
  • Применять экономно . Просто нанесите его на натуральный ноготь крошечными кругами (используя 5 ногтей за раз, прежде чем положить кисть обратно в бутылку), пока он не высохнет.
  • Избегайте прикосновения к окружающим мягким тканям при нанесении праймера.
  • Когда речь идет о грунтовках на кислотной основе, меньше значит больше!

Бескислотный праймер для ногтей

  • Наиболее предпочтительным и наиболее часто используемым продуктом для повышения адгезии продуктов к натуральной ногтевой пластине является бескислотный праймер.
  • Незаменим независимо от того, создаете ли вы гелевые ногти, акриловые ногти или маникюр с гель-лаком.
  • Гелевая технология , в частности, требует этого.
  • Улучшение не обесцветит и не обожжет кожу при использовании бескислотного праймера.
  • Используйте бескислотную грунтовку для обеспечения прочного сцепления .
  • Защищает модель от воздушных карманов и подъема изделия.
  • Чрезвычайно прочно связывает пластину с гель-лаком и гелевыми базами.

Самодельный праймер для ногтей или его заменитель

Самый простой способ сделать своими руками праймер для ногтей и дегидратор — использовать смесь ацетона и изопропилового спирта . Из-за влаги, а также из-за масла на ваших ногтях ваши акриловые краски, гель-лак и даже обычный лак не могут прилипнуть к вашей ногтевой пластине.

Как пользоваться

  • Нанесите на ногти слой спирта, затем слой ацетона .
  • Используя старую, но чистую кисточку для лака .
  • Чтобы очистить руки, нанесите изопропиловый спирт на ногти.
  • После того, как спирт испарится, вы можете нанести на ногти слой ацетона .
  • Дайте ацетону испариться. Наконец, как только ацетон полностью высохнет, вы можете начать пользоваться своей продукцией.

Преимущества

Когда на ногти наносится спирт, он убивает все микробы, которые могут быть на поверхности вашего ногтя. С другой стороны, жирные отложения растворяются , а грязь и мусор впоследствии удаляются при нанесении на ногти ацетона

Как нанести грунтовку для ногтей?

Бескислотный праймер

Первым компонентом вашего маникюра всегда является праймер. Нанесите бескислотный праймер на каждый ноготь почти сухой кистью, дайте ему высохнуть в течение примерно 40-60 секунд. Допустимо работать с не полностью испарившейся бескислотной грунтовкой, поскольку она не испарится полностью. Наносите базовое покрытие только на натуральный.

Кислотный праймер

Перед нанесением кислотного праймера нанесите 1-2 маленькие точки на ноготь . В результате он будет распространяться по ногтевой пластине самостоятельно. Перед нанесением гель-лака с кислотным праймером убедитесь, что он полностью испарился.

Типы и заменители праймера для ногтей и способы его нанесения

Дегидратор и праймер для ногтей

Средство для подготовки ногтей представляет собой обезжиривающую жидкость, которая перед нанесением праймера для ногтей мягко обезвоживает натуральную поверхность ногтя. с помощью дегидратора для ногтей. Этот продукт запечатывает поры ногтей после их полировки, чтобы сделать их матовыми. Он не изменяет собственный PH ногтя и поэтому рекомендуется для получения оптимальных результатов при выполнении услуги перманентного лака для ногтей.Использование его для нескольких услуг подряд может помочь нам свести к минимуму образование масла на ногтях во время нашей работы.

В чем разница между грунтовкой для ногтей и базовым покрытием

Праймер для ногтей

Праймер может удалить любую влагу, масло или жир с поверхности ваших ногтей . Результат будет хорошим и стойким, если после всего этого сделать маникюр. Цель праймера — обезвожить ногти, чтобы акрил или лак лучше держались. Вы должны использовать праймеры или дегидраторы, когда они действительно необходимы, например, при нанесении акриловых красок или когда вы склонны к отслаиванию или сколам.

Базовое покрытие

Базовое покрытие — это прозрачный лак, который наносится на ногти, чтобы сделать гель или обычный лак для ногтей более стойким. Они помогут вашему лаку лучше прилипнуть к ногтю, а также защитят ногти от окрашивания. Пластификаторы в базовых покрытиях улучшают их эластичность и сцепление с ногтем. Если ваши натуральные ногти кажутся желтоватыми, вам следует приобрести хорошее базовое покрытие, которое предотвращает образование пятен. Базовые покрытия защищают целостность ваших ногтей, образуя на них защитный слой.Это защитит ваши ногти от любых потенциально вредных химических веществ в лаке или геле, которые вы используете.

Различия между праймерами, клеями и дегидратами для ногтей — Nailistas — Nailistas

& NBSP


Что такое разница между в первую очередь для ногтей Ultrabond , Dehdrators , Приготовления ногтей Да Присоединяйтесь к ? Начнем с того, что все они праймеры Они подготовители маникюра и наносятся первыми.

Существует много путаницы по этому поводу, потому что у каждого бренда есть система и способ называть продукты. Я также знаю, что формулируют по-разному. Поэтому он не может обобщить , хотя я постараюсь как можно яснее объяснить, для чего предназначен каждый продукт.


Типы праймеров для ногтей

Хотя все они являются праймерами, существует три основные группы, на которые эти продукты делятся:

pH-выравниватели или дегидраторы : обезвоживают ноготь и регулируют pH.Они максимизируют адгезию и улучшают характеристики последующего продукта.

Бондеры : эти грунтовки улучшают адгезию и фиксацию. гарант или ультрабонд создает на натуральном ногте липкий слой (вы его увидите, потому что он блестит) и улучшает сцепление.

Кислотные грунтовки : Увеличивает пористость натурального ногтя. Они идеально подходят для акрила, а также обезвоживают ноготь.

В нейлерах у нас есть два типа праймера: бескислотный (дегидратор) и ultrabond (бондеры).оба могут быть использованы в сочетании с для повышения адгезии. Это я

Важно знать ногти, на которых собираетесь работать, некоторым практически не нужен праймер и продукты долго держатся на ногтях. Другим, однако, понадобится не один, а два праймера.


ABC ЧАСТО ЗАДАВАЕМЫЕ ВОПРОСЫ

Есть много сомнений, что вы спросите меня о праймерах для ногтей, здесь я собрал некоторые из самых интересных. Если у вас есть что-то, что не упомянуто в этом посте, вы можете отправить их мне в комментариях ниже.Мы всегда отвечаем.


Что такое лак для ногтей?

Этот продукт используется для подготовки ногтя перед нанесением продуктов для моделирования или постоянных основ. Существует несколько типов первых , некоторые из них используются для обезвоживания ногтей, другие для прикалывают продукт к ногтю, а также есть те, которые увеличивают пористость (первые кислоты).


Различия между Prime Acid и Non-Acid

Все праймеры с пометкой «некислотные» содержат некоторое количество кислоты, но в меньшей степени.Эти грунтовки служат для обезвоживания и открытия пор в случае, если мы собираемся применять акрил . Кислотные праймеры также можно использовать для ногтей с гипергидрозом и другими проблемами адгезии, поскольку они усиливают фиксацию. Также следует учитывать, что это более агрессивные продукты.

С другой стороны, если вам нужен бескислотный грунт , на этикетке должно быть указано «бескислотный» или бескислотный . Эти бескислотные грунтовки на самом деле являются дегидраторами .

Бескислотный праймер Nailistas (дегидратор)


Что такое дегидратор для ногтей?

Служат для удаления влаги и натуральных масел с поверхности ногтя. Вода и масло — враги маникюра, потому что в качестве материалов используются эмали, акрилаты и ацетаты. Им нужна сухая обезжиренная поверхность, так как они их отталкивают. Вот почему важно, чтобы предварительная подготовка ногтя с помощью пилки и дегидратора . Дегидратор повышает адгезию и стойкость лаков для ногтей и средств для моделирования.


Для чего нужен клей?

Также известен как дегидратор Где Препарат для ногтей . Они на самом деле одинаковы. И названий много, настолько, насколько бренд хочет назвать свой продукт. Нет единого мнения. Каждый бренд уникален, поэтому важно выяснить это, так как у каждого бренда есть руководство и порядок продуктов.


Что такое Ultrabond Bonder или Primer?

Клей – это продукт, который наносится на натуральный ноготь и используется для улучшения сцепления таких продуктов, как основа для эмали, акрил, полигель или гель.первый ультрабонд создает слой клея , который помогает зафиксировать наращенные натуральные ногти или перманентную эмаль. Увеличивает адгезию и срок службы накладных ногтей или перманентного маникюра.

Грунтовка сохнет в Led-лампе?


Отверждается ли грунтовка в УФ-лампе?

Первые осушители и кислоты испаряются в воздух. Некоторые бондеры да, они высыхают в УФ/светодиодной лампе, а некоторые высыхают на воздухе, но оба они все равно оставляют липкий слой.Не трогайте этот липкий слой. Всегда спрашивайте свой бренд, как использовать их продукты.


Что на первом месте: база или праймер?

Грунтовка всегда предшествует основе. Дегидратор или адгезив и ультрабонд применяются перед подготовкой ногтя к эмали.


Как отличить дегидратор от Ultrabond?

Все очень просто, дегидратор испаряет и оставляет ноготь слегка сухим, потому что он более беловатый.Ultrabond, с другой стороны, оставляет мерцающий , слегка маслянистый и липкий. Этот слой не следует удалять, он идеален для повышения адгезии.


Что на первом месте: грунтовка или клей?

Join Это дегидратор или регулятор PH, он предшествует другим праймерам, таким как ultrabond или первая кислота.


Что произойдет, если я не загрунтую ногти?

Если вы не наносите грунтовку, ваши ногти могут прослужить меньше или знать , чтобы выучить раньше.Это будет зависеть от ногтей, над которыми вы собираетесь работать. Некоторые люди имеют более толстые и сухие ногти, имеют более кислый pH, чем другие, и практически не нуждаются в грунтовке. Давайте возьмем в качестве примера ногти на ногах, они держатся намного дольше, чем ногти на руках, потому что у них есть другие характеристики.

Другим людям, наоборот, трудно долго сохранять свои ногти идеальными, на это может быть несколько причин. В этих случаях рекомендуется использовать первую наиболее агрессивную кислоту.


Что на первом месте: грунтовка или дегидратор?

Дегидратор всегда используется перед любой другой грунтовкой, такой как ультрабонд или кислотная грунтовка.Это служит для регулирования pH ногтя и


Подготовка или адгезия ногтей? Они одинаковые?

Да, действительно, все праймеры — это праймеры для ногтей, иначе их можно назвать, а прилипание — это одна из групп праймеров для ногтей: дегидраторы.

Оставляйте свои сомнения в комментариях, мы всегда ответим

ПОКАЗАТЬ ЕЩЕ

-nailistas-nailistas/
Все права защищены для оригинального контента (ссылка в верхней строке) автора
В соответствии с Законом об авторском праве в цифровую эпоху («DMCA»), Pub.L. 105-304 Если вы считаете, что ваша работа, защищенная авторским правом, нарушается, сообщите об этом нашей команде по электронной почте [email protected]

10 лучших праймеров для ногтей, которые стоит попробовать в 2021 году

Если вы любитель маникюра, вам очень хорошо. знайте, что ничто не сравнится с важностью использования лучшего праймера для ногтей, чтобы сохранить ваши ногти в безопасности и защитить. Маникюр — это отличные расслабляющие сеансы, которые украшают наши ногти и руки, украшая их красивыми рисунками и рисунками. Сегодня акриловый и гель-маникюр на пике популярности, так как они добавляют прочность и длину вашим натуральным ногтям.Им можно придать любую форму и размер, и они могут держаться до 6-8 недель. Однако, прежде чем вы начнете делать себе акриловые ногти, ваши ногти должны быть крепкими, гладкими и тщательно чистыми, чтобы помочь вам добиться наилучших результатов.

Здесь вам понадобится волшебство праймеров для ногтей. Он обрабатывает поверхность ваших ногтей, чтобы подготовить их к акриловым покрытиям и другим слоям лака для ногтей, чтобы они лучше держались на ногтях. Праймер для ногтей удаляет следы масла и жира с поверхности ногтя при правильном нанесении.Он также уравновешивает pH ваших ногтей, благодаря чему ваш маникюр остается дольше. Праймеры для ногтей также можно наносить на обычный или гель-лак для ногтей, чтобы предотвратить сколы или отслаивание. Тем не менее, грунтовка для ногтей наиболее рекомендуется, если вы делаете акриловый маникюр. Если вы хотите в ближайшее время сделать акриловый маникюр, просмотрите наш список из 10 лучших праймеров для ногтей, чтобы добиться гладкого и долговечного покрытия.

10 суперэффективных праймеров для маникюра на долгий срок

1. Праймер для ногтей Modelones

Подарите своим ногтям любовь и тщательно подготовьте их перед маникюром с помощью праймера для ногтей Modelones, который лучше всего подходит для склеивания натуральных ногтей с гелевым покрытием. полировать.Праймер уменьшает жирность ногтей и создает идеальную основу для гладкого и легкого нанесения гель-лака. Он увеличивает адгезию и быстро сохнет на воздухе, предотвращая образование пузырьков воздуха во время нанесения следующих слоев, так что у вас остается ослепительный маникюр, который держится долго и его нелегко снять.

Pros

    • Лучшие с гелем Polish
    • Работы на акриловых и искусственных ногтях
    • Уменьшает мальшечность
    • Увеличение Степень
    • Высыхание высыхает
    • Предотвращает пузырьки воздуха
    • Маникюр длится дольше
    • Polish.

    Минусы

    •  Может не работать с нажимом на гвозди

    2.Некислотная адгезионная грунтовка Young Nails Protein Bond

    Эта грунтовка с белковой адгезией придает ногтям некислотную адгезию без использования агрессивных химикатов. И имеет запатентованный полимер, который помогает связать лак для ногтей с кератиновой структурой ногтя. Праймер с белковой связью образует дополнительную липкую поверхность ногтя, благодаря чему лак легко прилипает и дольше держится. Два слоя праймера можно использовать с акриловыми красками, обычным лаком и твердым гелем, в то время как для обычных гель-лаков вы можете наносить праймер только на кончики ногтей.

    Pros

    • Некислотный
    • Некоррозийное грунтовку
    • Extra Laphy Surface
    • Маникюр длится дольше
    • Польский не будет поднимать легко
    • Может использоваться с регулярным, гелем и акрилами

    Минусы

    3. Праймер Aimeili Bond Primer

    Перед маникюром хорошо подготовить ногти, и один из способов сделать это — с помощью праймера Aimeili nail bond. Он подготавливает ваши ногти к прочному сцеплению, так что при нанесении УФ/светодиодного гелевого маникюра, строительного геля, акриловой пудры или порошка для погружения ваш маникюр будет долговечным с небольшими сколами.Вам не нужна УФ или светодиодная лампа во время нанесения быстросохнущего праймера, и это помогает предотвратить отрыв или поломку вашего дизайна ногтей, оставляя вам идеальный маникюр.

    Pro Pros

    • Увеличение постепенности
    • Высыхание
    • Высыхание Противоречие
    • Предотвращает пузырьки
    • Маникюр длится дольше
    • Польский не поднимется
    • УФ / светодиодная лампа необходима

    минус

  • некоторое время для просушки

4.Kanorine Acid-free Nail Primer

Если вы ищете некислотный праймер, который совместим как с вашими натуральными, так и с искусственными ногтями, возьмите грунтовку для ногтей Kanorine. Это лучший праймер для ногтей, который вы можете найти, который создает липкую поверхность, которая помогает подготовить ноготь к максимальной адгезии для гладкого и великолепного маникюра. Поскольку он натуральный и на основе смолы, у него нет резкого запаха, а формула также защищает ваши натуральные ногти, поскольку она нетоксична.

Pro Prov

  • Увеличение Степень
  • Высыхание
  • Некислотные
  • Натуральная смола на основе
  • Нетоксична
  • Низкий запах
  • Жестой без запаха
  • Маникюр длится дольше
  • без УФ / светодиодной лампы необходимо
  •  Можно использовать с обычными, гелевыми и акриловыми красками

Минусы

  •  Через несколько дней могут появиться сколы

5.Бескислотный праймер для ногтей Gelish ProBond

Если вы настроены на стойкий маникюр и планируете сделать маникюр с твердым гелем или акрилом, вы должны подготовить ногти с помощью бескислотного праймера для ногтей Gelish ProBond. Этот праймер наносится кистью, он некислотный и способствует увеличению адгезии настолько, что действует как «двусторонний скотч». Вы можете использовать это для гладкого нанесения и помочь сделать ваши твердые гелевые или акриловые ногти намного дольше!

Pro Prov

    • Увеличение постепенности
    • Некислотный
    • Используется для жесткого геля или акрилов
    • Гладкое приложение
    • Маникюр длится дольше

    минус

    • Там могут быть подъема быстрее, чем ожидалось

    6.Безкислотный праймер Morovan

    Устали от того, что жирные ногтевые пластины мешают идеальному маникюру? Не беспокойтесь об этом с бескислотным праймером Morovan, который уменьшает жирность ногтей и помогает создать липкую поверхность для максимальной адгезии, чтобы вы могли получить гладкий и успешный гель-маникюр! Он используется для приклеивания ваших натуральных ногтей к ногтям с УФ-гелем; воздух быстро сохнет и помогает предотвратить поднятие и скалывание ногтей. Он также изменяет pH ваших ногтей и помогает предотвратить образование пузырьков воздуха, что делает маникюр более стойким.

    Pro Pros

      • Увеличение Соблюда
      • Некислотный
      • Некислотный
      • Используется для ультрафиолетовых гелевых ногтей
      • Изменения ногтей PH
      • уменьшает маслянистость / смазку ногтей
      • Помогите предотвратить подъем
      • Уменьшает скольжение
      • Маникюр длится дольше

      Минусы

      • Работает только с УФ-гелевыми ногтями

      7. Mia Secret No Burn Acid Free Primer

      Предположим, вы столкнулись с проблемой жжения во время нанесения грунтовки для ногтей.В этом случае вы можете подумать о переходе на бескислотный праймер для ногтей Mia Secret, в состав которого входит XTRABOND, который не обжигает ваши натуральные ногти. Праймер для ногтей не содержит кислот и обезвоживает ваши натуральные ногти, уменьшая жирность и жирность, что обеспечивает лучшую адгезию, а ваши акриловые или УФ-гелевые ногти дольше остаются на ногтях и становятся более гладкими.

      Pro Pros

        • Без сжигания
        • беззаботный
        • Увеличение постепенности
        • Уменьшает маслянистость / смазка ногтей
        • Помогает предотвратить подъем
        • Работы с акрилами и УФ-гелем
        • Маникюр длится дольше

        Минусы

        • Может слегка пахнуть

        8.ibd LED/UV Bonder Primer

        Всегда неприятно, когда наши ногти начинают приподниматься через несколько дней после свежего маникюра, но с помощью LED/UV Bonder вы можете идеально подготовить и загрунтовать ногти, чтобы сохранить их максимально безопасными. Этот бондерный праймер для ногтей, подходящий для гель-лаков LED/UV, обеспечивает прочную адгезию и более длительную фиксацию, что помогает сохранить маникюр как можно дольше. Праймер без запаха не содержит кислоты, и для достижения наилучших результатов вы можете вылечить ногти с помощью УФ или светодиодной лампы.

        pros

          4 без кислоты
        • Увеличение приверженности
        • Помогает предотвратить подъем
        • Работы со светодиодом / УФ-гелем
        • AW SOWRELLET
        • Маникюр длится дольше
        • , вылеченные с использованием УФ / СИД лампы

        ;

        9. Бескислотный гель-праймер Apres

        Если ваши наращенные ногти приподнимаются чаще, чем вам хотелось бы, избегайте этого в следующий раз, используя бескислотный гель для маникюра Apres, который разработан для удаления маслянистости и жирности на ногтях. ваши натуральные ногти, чтобы ваш гель-маникюр мог держаться дольше.Его некислотная формула сводит к минимуму повреждение ваших ногтей, и вы можете выставлять напоказ свой маникюр в течение длительного времени, не беспокоясь о том, что он оторвется и сколется.

        Pro Pros

          4 Кислотно-Без
        • Увеличение приверженности
        • Помогает предотвратить лифтинг
        • Маникюр длится дольше
        • Уменьшает маслянистость / смазка ногтей
        • Используемое для гелевых ногтей

        минус

        • использовать только для нанесения гелевого покрытия на ногти

        10.Праймер для ногтей Tomicca Nail Bond Primer

        Подготовьте свои ногти к любому дизайну ногтей с помощью праймера для ногтей Tomicca, который является отличной основой для ваших ногтей перед маникюром. Этот бескислотный праймер можно использовать для приклеивания натуральных ногтей к ногтям с УФ-гелем для сильной фиксации и длительного маникюра. Праймер помогает уменьшить жирность ногтевой пластины, обеспечивая лучшее сцепление и не приподнимая ноготь в течение нескольких дней после маникюра. Высушите его на воздухе и получите долговечное приложение.

        Pro Pros

          4 без кислотного
        • Увеличение приверженности
        • Помогает предотвратить лифтинг
        • Маникюр длится дольше
        • Уменьшает маслинство / смазка ногтей
        • Используется для ультрафиолетовых гвоздик

      • Может использоваться только для нанесения УФ-геля на ногти.

      Итак, это наш список из 10 лучших праймеров для ногтей, которые вы можете выбрать перед следующим салонным или домашним маникюром! Если вам нужна помощь в выборе идеального для вас, то вот несколько вещей, которые вы можете иметь в виду перед покупкой.

      На что обратить внимание в грунтовке для ногтей

      • Сокращение маслаНе все грунтовки одинаковы, когда речь идет о прочности сцепления. Некоторые сильнее других. Если вы ищете еще более эффективный способ сохранить свои нарощенные волосы, вам следует посмотреть, обладают ли они свойствами уменьшения масла. Это сделает ваш ноготь более чистым и гладким перед нанесением для достижения наилучших результатов.
      •  КислотностьНекоторые праймеры для ногтей не бескислотны. Хотя это не так уж плохо, нельзя терпеть людей с чувствительными ногтями, которые могут повредиться во время нанесения.Поэтому, если вы беспокоитесь о чувствительности своих натуральных ногтей, поищите некислотный праймер для ногтей.
      •  ЗапахНесмотря на то, что трудно полностью избежать запаха, когда речь идет о наших ногтях, некоторые носы могут быть более чувствительными, чем другие. Если вы относитесь к категории людей с сильным обонянием, вы можете проверить грунтовку с минимальным запахом.

      Никому не понравится, когда великолепный, только что сделанный маникюр портится за короткое время из-за того, что наращенные ногти отрываются или скалываются. В этих случаях важно подготовить и загрунтовать ногти наилучшим образом, чтобы получить желаемые долгосрочные результаты.Праймеры являются важным шагом в процессе нанесения твердых гелевых и акриловых ногтей, поэтому, как только ваши натуральные ногти начнут расти, ваши нарощенные ногти не будут так легко отрываться из-за сильной адгезионной способности многих праймеров для ногтей. Дополнительные преимущества, такие как уменьшение маслянистости и жира на поверхности ногтей, также помогают содержать ногти в чистоте для идеального маникюра. Итак, теперь вы тоже можете выбрать один из этих 10 лучших праймеров для ногтей, чтобы начать следующий процесс маникюра. Вы можете купить его как для салонного использования, так и для домашнего использования.Получайте удовольствие от покупок!

      Почему стоит доверять StyleCraze?

      Автор этой статьи Чайтра Кришнан — энтузиаст макияжа, который любит пробовать разные продукты. Она составила список лучших праймеров для ногтей после тщательного изучения и просмотра онлайн-обзоров и отзывов пользователей. Ее список идеально подходит для тех, кто одержим сеансами маникюра и нейл-арта. Эти грунтовки не только продлевают жизнь маникюру, но и быстро сохнут и не повреждают кутикулу.

      Часто задаваемые вопросы

      Праймер для ногтей — это то же самое, что базовое покрытие для ногтей?

      Хотя и праймеры для ногтей, и базовые покрытия используются для продления срока службы лака для ногтей, это не одно и то же. Праймер для ногтей обычно используется перед нанесением акриловых, гелевых или искусственных ногтей, в то время как базовое покрытие чаще используется с обычным лаком для ногтей. Базовые покрытия образуют защитный слой на ваших ногтях, чтобы сохранить их здоровыми, в то время как праймеры используются для усиления фиксации при наращивании.

      Предотвращает ли грунтовка для ногтей грибок?

      Праймер для ногтей сохранит нарощенные ногти и надежно отполирует их, поэтому вероятность новых грибковых инфекций будет ниже, однако праймер не вылечит уже существующий грибок.

      Как долго хранится грунтовка для ногтей

      Праймеры для ногтей имеют неограниченный срок годности, если вы не даете им высохнуть.

      Когда наносить грунтовку для ногтей?

      В идеале перед нанесением акрилового или гелевого маникюра следует нанести грунтовку для ногтей, чтобы они держались дольше и держались более надежно.

      Рекомендуемые статьи

      Связанные

      Следующие две вкладки меняют содержимое ниже. Чайтра имеет тройную основную степень бакалавра в области журналистики, коммуникативного английского языка и экономики, а также степень магистра журналистики и… больше

      Beauty Company Beauty Factory — WWBD Group

      • BO.NAIL SYSTEMS

        BO. Толкатель для кутикулы

        4,90 € Вкл. налог 5,45 €

      • I.Am Nail Systems

        I.Am Precision Scissor

        10,83 € Вкл. налог

      • I.Am Nail Systems

        I.Am C-Curve Tweezer

        10,83 € Вкл. налог

      • I.Am Nail Systems

        I.Am Толкатель для кутикулы

        10,83 € Вкл. налог

      • I.Am Nail Systems

        I.Am Кусачки для кутикулы

        10,83 € Вкл. налог

      • I.Am Nail Systems

        I.Универсальные формы Am — 300 шт.

        30,85 € Вкл. налог

      • I.Am Nail Systems

        Лечебный набор I.Am

        21,18 € Вкл. налог

      • I.Am Nail Systems

        I.Am Gel System Try Me Kit

        32,67 € Вкл. налог

      • I.Am Nail Systems

        I.Am Fiber Gel Try Me Kit

        37,13 € Вкл. налог

      • I.Am Nail Systems

        I.Am Acrylic Try Me Kit

        25,41 € Вкл. налог

      • BO.NAIL SYSTEMS

        Акриловый стартовый набор BO.NAIL

        78,96 € Вкл. налог 87,73 €

      • BO.NAIL SYSTEMS

        BO.NAIL Acrylic Powder Cover Rose (25 г)

        8,17 € Вкл. налог €9,08

      • JACKY M.

        Русский Объем

        €6,88 Вкл. налог €22,93

      • ДЖЕКИ М.

        D LASH Mix

        6,15 € Вкл. налог 20,51 €

      • BO.NAIL SYSTEMS

        BO.NAIL AcryGel Babyboom Pink (60 г)

        14,10 € Вкл. налог 15,67 €

      • Ez Flow

        Акриловая пудра Cover Cool Pink

        6,43 € Вкл. налог 7,56 €

      • Без этикетки

        Показать подсказку Дисплей 72 шт.

        24,14 € Вкл. налог

      • Ez Flow

        Акриловый набор Time to Shine

        39,87 € Вкл.налог 46,91 €

      • JACKY M.

        Палетка для ресниц

        2,80 € Вкл. налог 9,32 €

      • Ez Flow

        A — Прозрачный полимер 226 г/8 унций

        7,15 € Вкл. налог 8,41 €

      МАГАЗИН

      N-фенилиминодиуксусная кислота в качестве протравки/праймера для бондинга дентина

      Эффективное сцепление композита с дентином было достигнуто путем последовательного использования разбавленного водного раствора азотной кислоты (HNO3) и ацетоновых растворов N-фенилглицина и мономера карбоновой кислоты, т.е.г., п-ПМДМ. Как предварительная обработка HNO3, так и полимеризация, инициируемая поверхностью в результате реакции инфузии N-фенилглицина и PMDM, были определены как ключевые элементы этой системы склеивания. В этом исследовании N-фенилиминодиуксусная кислота, уникальное производное иминокислоты с кислотным и хелатирующим потенциалом, оценивалась как двойное протравливающее средство/праймер для фиксации дентина. Рандомизированный 2 (3) факторный план был использован для изучения влияния 3 факторов на прочность связи при растяжении (TBS): кондиционер (HNO3 по сравнению сбез HNO3), праймер (N-фенилглицин против N-фенилиминодиуксусной кислоты) и растворитель праймера (ацетон против ацетона:h3O). Трехэтапный протокол, состоящий из HNO3, N-фенилглицина в ацетоне и PMDM в ацетоне, служил контролем. Проверяемая гипотеза заключалась в том, что N-фенилиминодиуксусная кислота может действовать как эффективный кондиционер (т.е. травитель) и как грунтовка. Двухэтапные протоколы, которые включали только N-фенилиминодиуксусную кислоту и PMDM, сравнивали с контролем. TBS (n = 10 на группу) определяли после 24-часового хранения в воде и анализировали с помощью ANOVA и критерия множественного диапазона Дункана.Растворитель праймера имел решающее значение для получения надежного сцепления с дентином, когда не применялась HNO3. N-фенилиминодиуксусная кислота в ацетоне без предварительного травления HNO3 дала самый низкий средний показатель TBS (95% ДИ, 3,8 +/- 1,9 МПа). Напротив, среднее значение TBS, полученное для образцов, обработанных N-фенилиминодиуксусной кислотой в ацетоне:h3O без предварительного травления HNO3, статистически не отличалось (p >

      0,05) от среднего значения TBS для контроля (95% ДИ, 9,3 ± 1,8 и 9,8 +/- 1,9 МПа соответственно). Благодаря двойной функции протравки и праймера N-фенилиминодиуксусная кислота в ацетоне:h3O обеспечивает упрощенную технику фиксации, обеспечивающую сильную адгезию к дентину, опосредованную ПМДМ.

      Метод мультиплексной ОТ-ПЦР в реальном времени для диагностики SARS-CoV-2 путем нацеливания на вирусные гены N, RdRP и RP человека

    • Worldometer. Пандемия коронавируса Ковид-19. (2021). https://www.worldometers.info/coronavirus (по состоянию на 5 сентября 2021 г.).

    • Вирсинга, В. Дж., Родс, А., Ченг, А. С., Пикок, С. Дж. и Прескотт, Х. К. Патофизиология, передача, диагностика и лечение коронавирусной болезни 2019 (COVID-19): обзор. JAMA 324 (8), 782–793 (2020).

      КАС пабмед Google ученый

    • Каруана Г. и др. Стратегии диагностики инфекции SARS-CoV-2 и интерпретация микробиологических результатов. клин. микробиол. Заразить. 26 , 1178–1182 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Кубина Р.и Дзидзич, А. Молекулярные и серологические тесты на COVID-19, сравнительный обзор лабораторной диагностики коронавируса SARS-CoV-2 и диагностики по месту оказания медицинской помощи.

      Диагностика 10 (6), 434 (2020).

      КАС ПабМед Центральный Google ученый

    • ВОЗ. Что мы знаем об иммунном ответе на COVID-19. (2020). https://www.who.int/docs/default-source/coronaviruse/risk-comms-updates/update-34-immunity-2nd.pdf?sfvrsn=8a488cb6_2 (по состоянию на 10 января 2021 г.).

    • ВОЗ (2020 г.). Лабораторное тестирование на новый коронавирус 2019 г. (2019-nCoV) в предполагаемых случаях заболевания человека. 20200117 (по состоянию на 10 января 2021 г.).

    • ВОЗ. Рекомендации по использованию иммунодиагностических тестов для диагностики COVID-19 в месте оказания медицинской помощи. (2020). https://www.who.int/news-room/commentaries/detail/advice-on-the-use-of-point-of-care-immunodiagnostic-tests-for-covid-19 (по состоянию на 10 января 2021 г.).

    • ЦКЗ. Обзор тестирования на SARS-CoV-2. (2020). https://www.cdc.gov/coronavirus/2019-ncov/hcp/testing-overview.html#:~:text=Authorized%20assays%20for%20viral%20testing,COVID%2D19%2C%20is%20 присутствует. (по состоянию на 14 января 2021 г.).

    • Корман, В. М. и др. Обнаружение нового коронавируса 2019 года (2019-nCoV) методом ОТ-ПЦР в реальном времени.

      Евронадзор 25 (3), 2000045 (2020).

      Центральный пабмед Google ученый

    • Чан, Дж.F.W. и др. Улучшенная молекулярная диагностика COVID-19 с помощью нового высокочувствительного и специфичного ПЦР-теста с обратной транскрипцией в реальном времени на COVID-19-RdRp/Hel, подтвержденного in vitro и с использованием клинических образцов. Дж. Клин. микробиол. 58 (5), e0031020 (2020).

      Google ученый

    • Чен В. и др. Обнаруживаемая вирусная РНК 2019-nCoV в крови является убедительным показателем дальнейшей клинической тяжести.

      Аварийный. микробы заражают. 9 (1), 469–473 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Фанг Ю. и др. Чувствительность КТ органов грудной клетки к COVID-19: сравнение с ОТ-ПЦР. Радиология 296 (2), E115–E117 (2020).

      Google ученый

    • Викрамаратна П.С., Патон Р.С., Гафари М.и Лоуренсо, Дж. Оценка вероятности ложноотрицательного результата теста на SARS-CoV-2 с помощью ОТ-ПЦР. Евронадзор 25 (50), 2000568 (2020).

      КАС ПабМед Центральный Google ученый

    • Ю, Ф. и др. Количественное определение и анализ вирусной нагрузки SARS-CoV-2 у инфицированных пациентов. клин. Заразить. Дис. 71 , 793–798 (2020).

      КАС пабмед Google ученый

    • Лонг Д.R. и др. Возникновение и время последующего положительного результата ОТ-ПЦР на SARS-CoV-2 среди изначально отрицательных пациентов. клин. Заразить. Дис. 72 (2), 323–326 (2021).

      КАС пабмед Google ученый

    • Ву, А. и др. Состав генома и дивергенция нового коронавируса (2019-nCoV), происходящего из Китая. Микроб-хозяин клетки. 27 , 325–328 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Ян, Дж. и др. Молекулярное взаимодействие и ингибирование связывания SARS-CoV-2 с рецептором ACE2. Нац. коммун. 11 , 4541. https://doi.org/10.1038/s41467-020-18319-6 (2020).

      ОБЪЯВЛЕНИЕ КАС Статья пабмед ПабМед Центральный Google ученый

    • Хуанг Ю. и др. Структурные и функциональные свойства шиповидного белка SARS-CoV-2: потенциальная разработка антивирусного препарата для COVID-19. Акта Фармакол. Грех. 41 , 1141–1149. https://doi.org/10.1038/s41401-020-0485-4 (2020 г.).

      КАС Статья пабмед ПабМед Центральный Google ученый

    • Накви, А. А. Т. и др. Взгляд на геном, структуру, эволюцию, патогенез и методы лечения SARS-CoV-2: подход структурной геномики. Биохим. Биофиз. Acta BBA Мол. Основа Дис. 1866 , 165878 (2020).

      КАС Google ученый

    • Хан С. и др. Коронавирусные заболевания 2019: Текущая биологическая ситуация и потенциальные терапевтические перспективы. евро. Дж. Фармакол. 886 , 173447 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Конрад, Р. и др. Быстрое создание лабораторной диагностики нового коронавируса SARS-CoV-2 в Баварии, Германия, февраль 2020 г. Евронадзор 25 (9), 2000173 (2020).

      Центральный пабмед Google ученый

    • Томбулоглу, Х., Сабит, Х., Аль-Сухайми, Э., Аль Джиндан, Р. и Алхарсах, К. Р. Разработка мультиплексного анализа ОТ-ПЦР в реальном времени для обнаружения SARS-CoV-2. PLoS ONE 16 (4), e0250942 (2021).

      КАС пабмед ПабМед Центральный Google ученый

    • Бегер Б. и др. Систематический обзор с метаанализом точности диагностических тестов на COVID-19. утра. Дж. Заразить. Контроль 49 (1), 21–29 (2021).

      ПабМед Google ученый

    • ЦКЗ. CDC 2019-Novel Coronavirus (2019-nCoV) Диагностическая панель RT-PCR в реальном времени. (2020). https://www.fda.gov/media/134922/download (по состоянию на 14 января 2021 г.).

    • Дахду Э., Ласаро-Перона Ф., Ромеро-Гомес М.P., Mingorance, J. & García-Rodriguez, J. Значения Ct из диагностических ПЦР-анализов SARS-CoV-2 не следует использовать в качестве прямой оценки вирусной нагрузки. Дж. Заражение. 82 , 414–451 (2020).

      ПабМед ПабМед Центральный Google ученый

    • Zhen, W. & Berry, G. J. Разработка нового мультиплексного анализа RT-PCR в реальном времени для обнаружения коронавируса тяжелого острого респираторного синдрома 2 (SARS-CoV-2). Дж.Мол. Диагн. 22 (12), 1367–1372 (2020).

      КАС пабмед Google ученый

    • Тахамтан, А. и Ардебили, А. ОТ-ПЦР в реальном времени при обнаружении COVID-19: проблемы, влияющие на результаты. Эксперт преподобный Мол. Диагн. 20 (5), 453–454 (2020).

      КАС пабмед Google ученый

    • Ван, С. и др. Молекулярно-эволюционные характеристики SARS-CoV-2, появившегося в США. J. Med. Вирол. 94 , 310–317 (2021).

      ПабМед ПабМед Центральный Google ученый

    • Пеньяррубиа, Л. и др. Множественные анализы в панели SARS-CoV-2 ОТ-ПЦР в реальном времени могут снизить риск потери чувствительности новыми геномными вариантами во время вспышки COVID-19. Междунар. Дж. Заразить. Дис. 97 , 225–229 (2020).

      ПабМед ПабМед Центральный Google ученый

    • GISAID (Глобальная инициатива по обмену всеми данными о гриппе.https://www.gisaid.org (по состоянию на 5 мая 2010 г.).

    • Katoh, K., Rozewicki, J. & Yamada, K.D. Онлайн-сервис MAFFT: множественное выравнивание последовательностей, интерактивный выбор последовательности и визуализация. Краткая информация. Биоинформ. 20 (4), 1160–1166 (2019).

      КАС пабмед ПабМед Центральный Google ученый

    • Уотерхаус, А. М., Проктер, Дж. Б., Мартин, Д. М., Клэмп, М. и Бартон, Г. Дж.Jalview Version 2 — Редактор множественного выравнивания последовательностей и инструментальные средства анализа. Биоинформатика 25 (9), 1189–1191 (2009).

      КАС пабмед ПабМед Центральный Google ученый

    • Браун, С. С. и др. PrimerPooler: автоматическое объединение праймеров для подготовки библиотеки к целевому секвенированию. биол. Протокол методов. 2 (1), bpx006 (2017).

      ПабМед ПабМед Центральный Google ученый

    • Унтергассер, А. и др. Primer3 — новые возможности и интерфейсы. Рез. нуклеиновых кислот. 40 (15), e115–e115 (2012).

      КАС пабмед ПабМед Центральный Google ученый

    • Li, Y., Zhou, Y., Ma, Y., Xu, R., Jin, X., & Zhang, C. Устойчивый к несовпадению метод RT-LAMP для молекулярной диагностики высоковариабельных вирусов. Био-протокол . 9 (21) (2019).

    • Донг Ю. и др. Сравнительная оценка 19 анализов изотермической амплификации, опосредованной петлей обратной транскрипции, для обнаружения SARS-CoV-2. Науч. 11 (1), 1–11 (2021).

      Google ученый

    • Арнаут, Р., Ли, Р. А., Ли, Г. Р., Каллахан, К., Йен, К. Ф., Смит, К. П., и др. Тестирование на SARS-CoV2: предел обнаружения имеет значение. биоРксив . (2020).

    • ЦКЗ.Часто задаваемые вопросы о мультиплексном анализе CDC DENV-1–4 RT-PCR в реальном времени. (2020). https://www.cdc.gov/dengue/healthcare-providers/testing/молекулярно-tests/faq_rt-pcr.html (по состоянию на 14 января 2021 г.).

    • ВОЗ. ПУБЛИЧНЫЙ ОТЧЕТ ВОЗ об оценке использования IVD в чрезвычайных ситуациях, вызванный коронавирусом (COVID-19). Октябрь 2020 г., версия 1.0. ЭУЛ-0517-204-00. (2020). https://extranet.who.int/pqweb/sites/default/files/documents/201005_final_pqpr_eul_0517_204_00_sars_cov2_nucleic_acid_detection%20%281%29.pdf. (по состоянию на 24 февраля 2021 г.).

    • ЦКЗ. Тестирование на COVID-19. (2020). https://www.cdc.gov/coronavirus/2019-ncov/symptoms-testing/testing.html (по состоянию на 14 января 2021 г.).

    • Шен, М. и др. Последние достижения и перспективы обнаружения нуклеиновых кислот коронавируса. Дж. Фарм. Анальный. 10 , 97–101 (2020).

      ПабМед ПабМед Центральный Google ученый

    • ВОЗ. Лабораторное тестирование на коронавирусную болезнь 2019 г. (COVID-19) при подозрении на случаи заболевания человека: временное руководство, 2 марта 2020 г. (No.ВОЗ/COVID-19/лаборатория/2020.4). (2020). Всемирная организация здоровья. (по состоянию на 10 января 2021 г.).

    • Деккер, Р. Дж., Энсинк, В. А., ван Леувен, С., Рауверда, Х., и Брейт, Т. М. Пересмотр неисправного контроля в рекомендованном CDC тесте ОТ-ПЦР на SARS-CoV-2. биоРксив . (2020).

    • Фан Т. Генетическое разнообразие и эволюция SARS-CoV-2. Заразить. Жене. Эвол. 81 , 104260 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Шэнь З. и др. Геномное разнообразие тяжелого острого респираторного синдрома-коронавируса 2 у пациентов с коронавирусной болезнью 2019. Клин. Заразить. Дис. 71 (15), 713–720 (2020).

      КАС пабмед Google ученый

    • Yi, H. Новый коронавирус 2019 года подвергается активной рекомбинации. клин. Заразить. Дис. 71 (15), 884–887 (2020).

      ПабМед Google ученый

    • Пал, А. и др. Полиморфный ландшафт геномов SARS-CoV-2, выделенных у населения Индии в 2020 г., демонстрирует быструю эволюцию ORF3a, ORF8, нуклеокапсидного фосфопротеина и шиповидного гликопротеина. Вычисл. биол. хим. 95 , 107594 (2021).

      КАС пабмед ПабМед Центральный Google ученый

    • Альварес-Диас, Д. А. и др. Молекулярный анализ нескольких внутренних протоколов rRT-PCR для обнаружения SARS-CoV-2 в контексте генетической изменчивости вируса в Колумбии. Заразить. Жене. Эвол. 84 , 104390 (2020).

      ПабМед ПабМед Центральный Google ученый

    • Безье, К., Антуан, Г. и Чарки, А. Надежность тестов ОТ-ПЦР в реальном времени для обнаружения SARS-Cov-2: обзор литературы. Междунар. Дж. Метрол. Квал. англ. 11 , 13 (2020).

      Google ученый

    • Свец Д., Тихопад А., Новосадова В., Пфаффл М. В. и Кубиста М. Насколько хороша оценка эффективности ПЦР: рекомендации по точной и надежной оценке эффективности количественной ПЦР. Биомоль. Обнаружить. Количественный 3 , 9–16 (2015).

      КАС пабмед ПабМед Центральный Google ученый

    • Vogels, C.B. et al. Сравнение аналитической чувствительности и эффективности наборов праймеров и зондов для SARS-CoV-2 RT-qPCR. Нац. микробиол. 5 (10), 1299–1305 (2020).

      КАС пабмед Google ученый

    • Пфефферле С., Рейхер С., Нёрц Д. и Лютгехетманн М. Оценка количественного анализа ОТ-ПЦР для обнаружения нового коронавируса SARS-CoV-2 с использованием высокопроизводительной системы. Евронадзор 25 (9), 2000152 (2020).

      Центральный пабмед Google ученый

    • Комплект GeneFinder™ COVID-19 Plus RealAmp https://www.fda.gov/media/137116/download (по состоянию на 15 декабря 2021 г.).

    • Поджио, П. и др. Цифровая ПЦР для высокочувствительного обнаружения вируса у ложноотрицательных пациентов с SARS-CoV-2. Науч. 11 (1), 1–7 (2021).

      Google ученый

    • Ухтег, К. и др. Сравнение аналитических характеристик трех методов молекулярной диагностики SARS-CoV-2. Дж. Клин. Вирол. 127 , 104384 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Хур, К. Х. и др. Оценка четырех коммерческих наборов для полимеразной цепной реакции с обратной транскрипцией SARS-CoV-2 в режиме реального времени, одобренных разрешением на экстренное использование в Корее. Фронт. Мед. 7 , 521 (2020).

      Google ученый

    • Цуй, Ф. и Чжоу, Х. С. Методы диагностики и потенциальные портативные биосенсоры для коронавирусной болезни, 2019 г. Биосенс. Биоэлектрон. 95 , 112349 (2020).

      Google ученый

    • Шейхзаде Э., Эйсса С., Исмаил А. и Зуроб М. Методы диагностики COVID-19 и новые разработки. Таланта 220 , 121392 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Bai, H., Cai, X. & Zhang, X. Ландшафтный тест на коронавирусную болезнь 2019 (тест на COVID-19) in vitro — сравнение ПЦР, иммуноанализа и теста на основе Crispr.https://doi.org/10.31219/osf.io/6eagn (2020 г.).

    • Листа М.Дж., Пейдж Р., Серткайя Х., Матос П., Ортис-Запатер Э., Магуайр Т.Дж., и др. . Устойчивые рабочие процессы диагностики SARS-CoV-2, включая тепловую инактивацию вируса. medRxiv . (2020).

    • Чжоу Ю. и др. Оценка чувствительности наборов для обнаружения нового коронавируса (SARS-CoV-2) 2019 г. для ОТ-ПЦР и стратегия снижения ложноотрицательных результатов. PLoS One 15 (11), e0241469 (2020 г.).

      КАС пабмед ПабМед Центральный Google ученый

    • Чу, Д.К. и др. Молекулярная диагностика нового коронавируса (2019-nCoV), вызвавшего вспышку пневмонии. клин. хим. 66 (4), 549–555 (2020).

      ПабМед ПабМед Центральный Google ученый

    • Lv, D.F. и др. Процесс динамического изменения генов-мишеней с помощью ОТ-ПЦР-тестирования SARS-Cov-2 в ходе лечения пациента с коронавирусной болезнью 2019 года. клин. Чим. Acta 506 , 172–175 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Ли, Д., Чжан, Дж. и Ли, Дж. Дизайн праймеров для количественной ПЦР в реальном времени для нового коронавируса SARS-CoV-2. Тераностика 10 (16), 7150 (2020).

      КАС пабмед ПабМед Центральный Google ученый

    • Границы | Влияние пищевых добавок поли-β-гидроксибутирата на рост, неспецифический иммунитет и кишечную микробиоту морского огурца Apostichopus japonicus

      Введение

      Неправильное использование антибиотиков для борьбы с болезнями аквакультуры привело к серьезному загрязнению окружающей среды (Sapkota et al., 2008). Бесконтрольное применение антибиотиков сильно мешало устойчивому развитию аквакультуры из-за остатков лекарств, резистентности бактерий, подавления иммунитета и дисбаланса кишечной микробиоты (Sapkota et al., 2008; Das et al., 2009). Кроме того, неправильное использование антибиотиков повышает риск передачи антибиотикорезистентности водным животным и патогенам человека, что угрожает здоровью человека (Cabello, 2006; Defoirdt et al., 2007). Таким образом, разработка экологически чистых стратегий биоконтроля для замены антибиотиков является ключом к обеспечению здорового и устойчивого развития индустрии аквакультуры.

      Поли-β-гидроксибутират (ПГБ) представляет собой биополимер, состоящий из линейных цепей звеньев (R)-3-гидроксибутирата (3ГБ) (Jendrossek and Pfeiffer, 2014). Он безопасен, нетоксичен, биоразлагаем и гистосовместим и широко используется в материалах для защиты окружающей среды, биомедицинских материалах и сельскохозяйственном производстве (Liu et al., 2010; Zhang et al., 2018). ПОБ нерастворим в воде, но может деполимеризоваться в водорастворимых мономерах короткоцепочечных жирных кислот в кишечнике и поглощаться животными.ПГБ также может быть источником углерода для обеспечения энергией роста водных животных. Таким образом, ПОБ считается экологически безопасным альтернативным биоконтролирующим соединением для некоторых культивируемых водных животных. Предыдущие исследования показали, что ПОБ может улучшить рост, иммунитет и выживаемость некоторых животных (Hung et al., 2015). Кроме того, ПОБ поддерживает слабокислую среду в кишечнике и способствует размножению полезных микроорганизмов (Halet et al., 2007; Nhan et al., 2010).Рационы с добавлением ПОБ улучшают показатели роста и выживаемость молоди европейского морского окуня ( Dicentrarchus labrax ) (De Schryver et al., 2010), сибирского осетра ( Acipenser baerii ) (Najdegerami et al., 2012), китайской рукавицы крабы ( Eriocheir sinensis ) (Sui et al., 2016), синие мидии ( Mytilus edulis ) (Hung et al., 2015) и белые креветки ( Litopenaeus vannamei ) (Gao et al., 2019) . Более того, Najdegerami et al. (2012), Sui et al.(2016) обнаружили, что диетический ПОБ увеличивает видовое богатство и разнообразие кишечных микробов сибирского осетра и китайского мохнатого краба соответственно. Суи и др. (2012), Хунг и соавт. (2015) обнаружили, что диетический ПОБ повышает устойчивость к болезням против патогенных микроорганизмов у китайских мохнатых крабов и голубых мидий. В настоящее время ПОБ в основном используется в качестве кормовой добавки в аквакультуре рыб и ракообразных; однако, согласно нашим сведениям, о влиянии диетического ПОБ на морской огурец Apostichopus japonicus сообщается редко.

      Морской огурец A. japonicus является важным экономическим ресурсом и представляет собой вид аквакультуры, широко распространенный в Китае, Японии, Южной Корее и России (Li et al., 2020). В качестве питателя отложений морские огурцы ежедневно поглощают пищу, превышающую их массу тела, такую ​​как неорганические минеральные частицы и неперевариваемые гуминовые вещества (Lopez and Levinton, 1987). Однако состав пищеварительной системы у морского огурца очень прост, и он в основном зависит от кишечного тракта для преобразования пищи и поглощения питательных веществ.Способность его кишечника выполнять переваривание тяжелой пищи и поглощение питательных веществ для обеспечения себя питательными веществами и энергией может быть тесно связана с трансформацией и разложением кишечной микробиоты. Кишечные микроорганизмы считаются вторым геномом и играют жизненно важную роль в пищеварении и усвоении питательных веществ хозяином, иммунном ответе и развитии органов (Yamazaki et al., 2016; Liu et al., 2019). Ямазаки и др. (2016) сообщили об обилии кишечного микробиома, сохраняющего гены метаболизма ПОБ, у более крупных A.japonicus , которые могут происходить от Rhodobacterales (более подробно Rhodobacteraceae ). Различия в кишечной микробиоте у крупных и мелких особей могут быть связаны с синтетическим метаболизмом ПОБ (Yamazaki et al., 2016). Предыдущие исследования показывают, что Rhodobacteraceae играли активную роль в поддержании здоровья и ускорении роста водных животных (Liu et al., 2019; Huang et al., 2020). Кроме того, Ян и соавт.(2015b) показали, что активация сигнального пути ядерного фактора-κB (NF-κB) усиливает иммунный ответ морских огурцов и связана со значительным увеличением потенциального пробиотика Rhodobacteraceae в кишечнике A. japonicus .

      Следовательно, мы посчитали, что рационы с добавлением ПОБ могут улучшить относительную численность Rhodobacteraceae , что может быть связано с улучшением показателей роста и иммунитета морских огурцов.Это исследование было разработано для изучения влияния пищевых добавок с различными дозами ПОБ на показатели роста, неспецифический иммунитет, гены, связанные с иммунной системой ( Aj -p105, Aj -p50, Aj -rel и ). Aj -lys) профили экспрессии в сигнальном пути NF-κB и микробиота кишечника для A. japonicus. Подходящая добавочная доза PHB в рационе A. japonicus была изучена, чтобы обеспечить практический ориентир для улучшения технологии выращивания, разработки кормов и борьбы с болезнями для A.японский .

      Материалы и методы

      Экспериментальные животные и рационы

      Морские огурцы были приобретены у Yantai Anyuan Aquatic Products Co., Ltd. (Яньтай, Китай). Перед кормлением трепангов выращивали в емкостях (объемом 1000 л) и кормили основным рационом в течение 15 дней для акклиматизации к лабораторным условиям (температура 18 ± 1°С, соленость 28–30‰, рН 7,8–8,2, растворенный кислород 8,0 ± 0,2 мг/л). После акклиматизации трепангов не кормили в течение 24 ч, затем 200 особей аналогичного размера (средняя масса тела около 6,0 г).48 г) были случайным образом распределены по 20 аквариумам (55 см × 30 см × 35 см). В каждом аквариуме по 10 особей, а каждая обработка включает пять аквариумов.

      Поли-β-гидроксибутират (ПГБ) (размер частиц 10–50 мкм) был приобретен у Ningbo Tianan Biological Material Co., Ltd. (Нинбо, Китай). Основной рацион был приготовлен из 70 % морской грязи, 15 % порошка саргассума и 15 % коммерческого корма из морских огурцов (сухой вес). Все ингредиенты измельчали ​​в порошок через 320 меш, взвешивали пропорционально и тщательно перемешивали.Основной рацион содержит 20% сырого протеина и 2,5% сырого липида. Экспериментальные рационы готовили путем добавления к основному рациону различных доз ПОБ в пересчете на массу ( w / w ), с добавлением 0, 0,5, 1 и 3% ПОБ в качестве обработки C (контроль), P лечение, лечение OP и лечение TP соответственно. Порошкообразные экспериментальные рационы ежедневно смешивали со стерильной морской водой (собирались в массу, а не диспергировали в воде) и скармливали голотуриям в течение 1 ч для гарантии свежести рационов.

      Пробное кормление и управление

      Морских огурцов кормили до насыщения экспериментальными диетами один раз в день в 18:00 в течение 63 дней. Несъеденный корм и фекалии удаляли сифонированием перед следующим кормлением, а 1/3 воды в каждом аквариуме ежедневно обменивали на свежую морскую воду. Водные условия для эксперимента были такими же, как и для поддерживающей стадии. Морские огурцы выращивали при 14-часовом световом цикле и 10-часовом темновом фотопериоде.

      Измерение роста и выживания

      В конце эксперимента с кормлением регистрировали окончательное количество и среднюю массу морского огурца в каждом аквариуме.Удельную скорость роста (SGR) (%/d), скорость роста массы тела (WGR) (%) и выживаемость (SR) (%) рассчитывали по следующим формулам:

      SGR=(LnWt-LnW0)×100/т

      WGR=(Wt-W0)/Wt×100

      СР=Nt×100/N0

      Откуда W и и W и W 0 0 — это финальные и начальные веса, т — это пробный пробный период в дни (D), и N и N 0 — конечное и начальное количество трепангов в каждом аквариуме соответственно.

      Коллекция образцов

      В конце эксперимента с кормлением морские огурцы не кормились в течение 24 часов. Из каждого аквариума брали по три трепанга, кожу которых стерилизовали 70%-ным этанолом. Затем из брюшной полости стерильным шприцем на 1 мл (игла 25-го калибра) собирали целомическую жидкость каждого трепанга и тщательно смешивали с равным объемом антикоагулянта (0,02 М ЭГТА, 0,48 М NaCl, 0,019 М KCl и 0,068 М Трис). -HCl; pH = 7,6). Целомоциты в целомической жидкости подсчитывали и выражали в виде клеток на мл.Свежую целомическую жидкость делили на две части, одну часть использовали для тестов активности фагоцитоза (ФА) и активности респираторного взрыва (РБ), другую центрифугировали при 3000 × g , 4°С в течение 10 мин для сбора целомоцитов. Целомоциты ресуспендировали в равном объеме 0,85% стерильного ледяного физиологического раствора и обрабатывали ультразвуком при 22 кГц, 0°С в течение 30 с. Затем суспензию центрифугировали при 4000 × г , 4°C в течение 10 мин для сбора супернатанта клеточного лизата (CLS) на супероксиддисмутазу (SOD), каталазу (CAT), кислую фосфатазу (ACP), щелочную фосфатазу ( AKP) и тесты на активность лизоцима (LZM).

      Вентральную поверхность каждого морского огурца рассекали стерильным скальпелем от ануса, чтобы обнажить полость тела. Содержимое кишечника и ткани средней кишки собирали в стерильные пробирки соответственно. Образцы подвергали мгновенной заморозке в жидком азоте и хранили при –80°С. Содержимое кишечника использовали для анализа кишечной микробиоты, а ткани средней кишки использовали для определения относительных уровней экспрессии генов, связанных с иммунитетом ( Aj -p105, Aj -p50, Aj ). -rel и Aj -lys).

      Инактивация

      Vibrio splendidus Тест на стимуляцию

      Очищенный штамм V. splendidus инокулировали в жидкую среду с морской водой 2216E и культивировали в течение 24 ч при 28°C, 150 об/мин во встряхиваемых бутылях. Таллом V. splendidus собирали центрифугированием в течение 10 мин при 5000 × г , 4°С. Затем таллом трижды промывали стерильным фосфатно-солевым буфером (PBS) и добавляли равный объем 0,85% стерильного ледяного физиологического раствора для приготовления суспензии.К суспензии добавляли раствор формальдегида до конечной концентрации 0,5%, затем инкубировали в течение 24 ч при 28°C для инактивации V. splendidus . Среду для твердых чашек 2216E покрывали инактивированным V. splendidus и культивировали в течение 24 ч при 28°C. Отсутствие бактериальных колоний на чашках свидетельствовало о полной инактивации V. splendidus . Затем инактивированный таллом собирали и трижды промывали стерильным PBS для удаления остаточного формальдегида.Наконец, инактивированный таллом превращали в бактериальную суспензию 2,57 × 10 8 КОЕ/мл с 0,85% стерильным ледяным физиологическим раствором.

      В конце эксперимента с кормлением 30 морских огурцов из каждой обработки были поровну распределены по трем аквариумам. Затем 100 мкл инактивированного V. splendidus вводили в целомическую полость каждого морского огурца и выращивали в течение 168 часов, что соответствовало испытанию на кормление. Ткань средней кишки трех морских огурцов собирали через 24, 72 и 168 часов после инъекции соответственно.Ткани средней кишки немедленно помещали в жидкий азот и хранили при температуре –80°C для определения уровня экспрессии иммунозависимых генов.

      Анализ неспецифических иммунных параметров

      Активность фагоцитоза

      Фагоцитозную активность целомоцитов оценивали методом нейтрального красного по Yang et al. (2015a) с некоторыми изменениями. 100 мкл свежей целомической жидкости из каждой повторности вносили в 96-луночный микропланшет и инкубировали 30 мин при 25°С.Затем удаляли супернатант, добавляли в каждую лунку по 100 мкл 0,029% нейтрального красного (G-CLONE, Китай) и инкубировали 30 мин при 25°С. Каждую лунку тщательно промывали три раза PBS, затем добавляли 100 мкл буфера для лизиса клеток (уксусная кислота:этанол = 1:1, об./об.) и инкубировали в течение 20 мин при комнатной температуре. Оптическую плотность каждой лунки измеряли при 540 нм с помощью устройства для считывания микропланшетов (Thermo, BioTeK, Winooski, VT, США). Фагоцитозную активность целомоцитов выражают как оптическую плотность 1 × 10 6 клеток.

      Активность респираторного взрыва

      Респираторную взрывную активность целомоцитов оценивали с помощью окрашивания нитросиним тетразолием (NBT) (Sigma Aldrich, Сент-Луис, Миссури, США) по методу Yang et al. (2015а) с некоторыми изменениями. В каждую лунку 96-луночного микропланшета предварительно добавляли 100 мкл 0,2% раствора поли-L-лизина (PLL) (Sigma Aldrich, Сент-Луис, Миссури, США), встряхивали в течение 30 с и оставляли для 2 ч при комнатной температуре. В каждую лунку добавляли по 100 мкл свежей целомической жидкости, центрифугировали 10 мин при 300× г , 4°С.Супернатант удаляли, в каждую лунку добавляли по 100 мкл форбола 1,2-миристата 1,3-ацетата (1 мкг/мл; РМА, США) и инкубировали микропланшет при 37°С в течение 30 мин. Затем в каждую лунку добавляли по 100 мкл 0,3% НСТ и инкубировали 30 мин при 37°С для окрашивания клеток. Затем 96-луночный микропланшет центрифугировали при 560 × g в течение 10 мин при 4°С. Супернатант удаляли и добавляли 200 мкл абсолютного метанола для остановки реакции на 10 мин при 4°С. Затем 96-луночный микропланшет центрифугировали 10 мин при 700 × g , 4°С и отбрасывали супернатант.Каждую лунку трижды промывали 70% метанолом и сушили на воздухе при комнатной температуре. Затем добавляли 120 мкл 2 М раствора гидроксида калия КОН и 140 мкл диметилсульфоксида (ДМСО, Sigma, США) и определяли окраску при 630 нм с помощью микропланшет-ридера (Thermo, BioTeK, США) с КОН/ДМСО. как пустышка. Активность респираторного взрыва целомоцитов выражается как поглощение 1 × 10 6 клеток.

      Активность неспецифических иммунных ферментов
      Для оценки активности SOD, CAT, ACP, AKP и LZM в CLS использовали наборы неспецифических иммунных ферментов

      (Nanjing Jiancheng Bioengineering Institute, Китай) в соответствии с протоколами производителя.Одну единицу активности СОД определяли как количество фермента, необходимое для ингибирования скорости восстановления ксантина на 50% в 1 мл реакционного раствора. Одну единицу активности КАТ определяли как количество фермента, необходимое в 1 мл CLS для разложения 1 мкмоль H 2 O 2 в секунду. За единицу активности АСР принимали 1 мг фенола, высвобождаемого 100 мл CLS, прореагировавшего с матрицей за 30 мин при 37°С. За единицу активности AKP принимали 1 мг фенола, высвобождаемого 100 мл CLS, прореагировавшего с матрицей за 15 мин при 37°C.Одну единицу активности LZM определяли как количество фермента, необходимое для снижения абсорбции со скоростью 0,001/мин⋅мл.

      Экспрессия генов, связанных с иммунитетом, в среднем отделе кишечника

      Относительные уровни экспрессии генов
      Aj -p105, Aj -p50, Aj -rel и Aj -lys Суммарную РНК выделяли из ткани среднего отдела кишечника трепанга в количестве

      в каждом аквариуме с помощью Trizol Reagent (Ambion, США) по протоколу производителя.Концентрацию тотальной РНК определяли на микроспектрофотометре Nano-300 (Allsheng, Китай), целостность определяли электрофорезом в 1,5% агарозном геле. Затем тотальную РНК подвергали обратной транскрипции в комплементарную ДНК (кДНК) с помощью набора реагентов PrimeScript™ RT (Takara, Japan). Количественную ПЦР в реальном времени (RT-qPCR) проводили в количественном термоциклере (Applied Biosystems, США). Программа ПЦР: 95°С 2 мин, затем 40 циклов 95°С 10 с, 60°С 10 с, 72°С 20 с, затем 95°С 15 с, 60°С 1 мин, 95°С в течение 1 с.Каждая проба была проведена с тремя дубликатами. В табл. реакции был проведен анализ кривой плавления для проверки амплификации одного продукта. Относительные уровни экспрессии генов Aj -p105, Aj -p50, Aj -rel и Aj -lys рассчитывали методом сравнительной КТ 2 –ΔΔCT .

      Таблица 1. Последовательности праймеров внутреннего эталона и генов-мишеней для ПЦР в реальном времени.

      Относительные уровни экспрессии генов
      Aj -p105, Aj -p50, Aj -rel и Aj -lys после инактивации Vibrio splendidus Стимулирующий тест

      Относительные уровни экспрессии генов Aj -p105, Aj -p50, Aj -rel и Aj -lys в средней кишке трепанга измеряли через 24, 72 и 168 ч. , соответственно.Метод выделения и детекции тотальной РНК, процесс RT-qPCR и метод расчета уровня экспрессии генов были такими же, как описано в разделе «Относительные уровни экспрессии Aj -p105, Aj -p50, Aj — rel и Aj -lys Genes».

      Анализ кишечной микробиоты

      Экстракция ДНК и секвенирование гена 16S рРНК
      Тотальную ДНК

      экстрагировали из содержимого кишечника A. japonicas с использованием набора для выделения ДНК PowerFecal (Mobio, Карлсбад, США) в соответствии с протоколом производителя.Участок V3-V4 бактериального гена 16S рРНК амплифицировали с помощью ПЦР (95°С, 3 мин, затем 25 циклов: 95°С, 30 с, 55°С, 30 с и 72°С, 45 с, с окончательное удлинение при 72°C в течение 10 мин) с использованием набора праймеров 338F (ACTCCTACGGGAGGCAGCAG) и 806R (GGACTACHVGGGTWTCTAAT). Реакции ПЦР проводили в трех повторностях с 20 мкл смеси, содержащей 4 мкл 5 × буфера FastPfu, 2 мкл 2,5 мМ dNTP, 0,8 мкл каждого праймера (5 мкМ), 0,4 мкл полимеразы FastPfu и 10 нг матричной ДНК. Качество продуктов ПЦР определяли с помощью электрофореза в 2% агарозном геле.Затем очищенные продукты ПЦР секвенировали на платформе Illumina MiSeq компании Majorbio Bio-pharm Technology Co., Ltd (Шанхай, Китай). Необработанные данные последовательности 16S рРНК были отправлены в базу данных Sequence Read Archive (SRA) Национального центра биотехнологической информации (NCBI) под номером доступа PRJNA781084.

      Обработка данных секвенирования

      Необработанные данные секвенирования обрабатывали с помощью программного обеспечения Quantitative Insights Into Microbial Ecology (QIIME 2, версия 2020.11; Болиен и др., 2019). Все химерные и низкокачественные прочтения были удалены, а квалифицированные последовательности были сгруппированы в рабочие таксономические единицы (OTU) с отсечкой 97%. Альфа- и бета-разнообразие бактериального сообщества анализировали путем объединения программных пакетов QIIME 2, SPSS 22.0 (IBM, Армонк, Нью-Йорк, США) и R (версия 4.0.4; Free Software Foundation, Inc., Бостон, США). Анализ альфа-разнообразия включал Chao1, оценку покрытия на основе численности (ACE), анализ Шеннона, Симпсона и индекса покрытия.Бета-разнообразие было проанализировано с помощью неметрического многомерного шкалирования (NMDS) на основе невзвешенных показателей UniFrac. Различные распространенные таксоны между контролем и различными видами лечения PHB были идентифицированы с помощью размера эффекта линейного дискриминантного анализа (LDA) (LEfSe) в сети Galaxy на основе непараметрического факториального критерия суммы рангов Крускала-Уоллиса.

      Строительство молекулярно-экологической сети

      Молекулярно-экологические сети кишечной микробиоты были построены на основе относительной численности OTU при лечении.Для создания сети в каждой обработке использовали пять биологических повторов. Построение сетей и идентификация топологических ролей OTU выполнялись на основе теории случайных матриц (RMT) с использованием онлайн-конвейера MENA. В сети один узел представлял один OTU. Процедура быстрой жадной модульной оптимизации использовалась для модульного разделения сети. Для сравнения различных сложных сетей было построено 100 случайным образом перемонтированных сетей с использованием процедуры Маслова-Снеппена для каждой идентифицированной сети.Средний коэффициент кластеризации (avgCC), среднее расстояние пути (GD) и модульность всех случайных сетей были рассчитаны для проверки различий между молекулярными экологическими сетями и случайными сетями на основе теста Z . Связность внутри модуля ( Zi ) и связность между модулями ( Pi ) описывают, насколько хорошо узел связан с другими узлами в том же модуле и степень связности этого узла с другими модулями, соответственно. Топологические роли OTU были разделены на четыре категории: (i) периферийные узлы ( Zi ≤ 2.5, Pi ≤ 0,62), (ii) разъемы ( Zi ≤ 2,5, Pi > 0,62), (iii) втулки модулей ( Zi > 2,5, Pi ≤ 0,62) и (iv) Сетевые концентраторы ( Zi > 2,5, Pi > 0,62) (Дэн и др., 2012). Cytoscape 3.8.0 использовался для визуализации сети (Cline et al., 2007).

      Функциональный прогностический анализ кишечной микробиоты

      Функциональные прогнозы микробиоты кишечника были основаны на индивидуальных профилях OTU, классифицированных в базе данных Greengenes (Greengenes 13.8). Анализ путей OTU, проведенный Киотской энциклопедией генов и генома (KEGG), был сделан с использованием Филогенетического исследования сообществ путем реконструкции ненаблюдаемых состояний (PICRUSt 2.4.1; Langille et al., 2013). Статистический анализ микробных функций при лечении проводили с использованием пакета программного обеспечения «Статистический анализ метагеномных профилей» (STAMP 2.1.3; Parks et al., 2014). Значительно отличающиеся пути KEGG между контролем и другими видами лечения были идентифицированы с использованием двустороннего t-критерия Уэлча, где P <0.05 считается значительным.

      Статистический анализ

      Результаты представлены как среднее значение ± стандартная ошибка. Данные были проанализированы с помощью однофакторного дисперсионного анализа с последующим многодиапазонным тестом Дункана с использованием SPSS 22.0. Достоверные различия были установлены на уровне P <0,05.

      Результаты

      Производительность роста и выживание

      Диетический PHB значительно увеличил конечную массу, удельную скорость роста (SGR) и прирост массы (WG) морских огурцов ( P < 0.05). При этом самые высокие значения конечной массы, SGR и WG наблюдались при обработке ОП. Конечный вес, SGR и WG морского огурца при обработках P и OP были значительно выше, чем при обработке TP, и не наблюдалось существенной разницы между обработками P и OP ( P > 0,05). Никакой разницы в выживаемости (SR) между видами лечения не наблюдалось ( P > 0,05) (таблица 2).

      Таблица 2. Показатели роста морских огурцов ( Apostichopus japonicus ), получавших рационы с различными уровнями поли-β-гидроксибутирата (ПГБ).

      Неспецифические параметры иммунитета

      Фагоцитарная активность и активность респираторного взрыва в целомоцитах

      Фагоцитарная активность целомоцитов и активность респираторного взрыва для трепанга при обработках P и OP были значительно выше, чем в контроле и при обработке TP ( P <0,05). Однако не наблюдалось никаких различий между контролем и обработкой TP ( P > 0,05), а также между обработками P и OP ( P > 0.05) (рис. 1А,Б).

      Рисунок 1. Эффекты диетического поли-β-гидроксибутирата (ПГБ) на (A) фагоцитарную (PA), (B) респираторный взрыв (RB), (C) супероксиддисмутазу (SOD), (D) активность каталазы (CAT), (E) кислой фосфатазы (ACP), (F) щелочной фосфатазы (AKP) и (G) активности лизоцима (LZM) в целомоцитах трепанга ( Apostichopus japonicus ). Столбцы представляют среднее значение ± стандартная ошибка ( n = 5).Различные буквы на каждой фигуре обозначают существенные различия ( P <0,05). К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Активность неспецифических иммунных ферментов в целомоцитах

      Активность SOD и AKP целомоцитов при обработках P и OP была значительно выше, чем в контроле и при обработке TP ( P < 0.05). Однако существенных различий между обработками P и OP, а также между контрольной обработкой и обработкой TP ( P > 0,05) не наблюдалось (рис. 1C, F). CAT-активность целомоцитов при обработках OP и TP была значительно выше, чем в контроле и при обработках P ( P <0,05). Никакой разницы между контролем и обработкой P не наблюдалось ( P > 0,05), а активность CAT при обработке OP была значительно выше, чем при обработке TP ( P < 0.05) (рис. 1D). Активность АСР целомоцитов при обработке ОП была значительно выше, чем при других обработках ( P <0,05), а обработка P была значительно выше, чем при обработке контролем и TP ( P <0,05). Не было никакой разницы между контролем и обработкой TP ( P > 0,05) (рис. 1E). Активность LZM при обработке OP была значительно выше, чем при других обработках ( P <0,05), тогда как между контролем, P и TP различий не наблюдалось ( P > 0.05) (рис. 1G).

      Относительные уровни экспрессии генов

      Aj -p105, Aj -p50, Aj -rel и Aj -lys в среднем отделе кишечника

      Как показано на рисунке 2, относительные уровни экспрессии генов Aj -p105, Aj -p50 и Aj -rel при лечении ПГБ были значительно выше, чем в контроле ( P <0,05). ). Между тем относительные уровни экспрессии генов Aj -p105, Aj -p50, Aj -rel и Aj -lys при лечении ОП были значительно выше, чем при других вариантах лечения ( P < 0 .05). Кроме того, относительный уровень экспрессии гена Aj -p105 при обработке P был значительно выше, чем при обработке TP ( P <0,05). Относительный уровень экспрессии гена Aj -p50 при обработке TP был значительно выше, чем при обработке P ( P <0,05). Не было различий в относительных уровнях экспрессии гена Aj -rel между обработками P и TP ( P > 0,05). Не было никакой разницы в относительных уровнях экспрессии гена Aj -lys среди контрольной обработки, обработки P и TP ( P > 0.05).

      Рис. 2. Относительные уровни экспрессии генов Aj -p105, Aj -p50, Aj -rel и Aj -lys в ткани средней кишки трепанга при 0, 24 , 72 и 168 ч после стимуляции инактивированным Vibrio splendidus . Временная точка 0 часов представляет относительный уровень экспрессии генов, связанных с иммунитетом, в конце 63-дневного испытания с кормлением. Столбцы представляют среднее значение ± стандартная ошибка ( n = 5). Разные буквы в один и тот же момент времени обозначают существенные различия ( P < 0.05). * обозначает значительно различающиеся уровни экспрессии генов, связанных с иммунитетом, между различными временными точками и временной точкой 0 ч ( P <0,05). К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Относительные уровни экспрессии генов

      Aj -p105, Aj -p50, Aj -rel и Aj -lys в средней кишке после инактивации Vibrio splendidus Инъекция

      Относительные уровни экспрессии генов Aj -p105, Aj -p50, Aj -rel и Aj -lys после введения инактивированного V.splendidus показаны на рис. 2. Относительные уровни экспрессии гена Aj -p105 значительно повышались через 24 и 72 ч при обработке P, через 24, 72 и 168 ч при обработке OP и при 72-часовой момент времени при лечении TP ( P <0,05). Относительные уровни экспрессии гена Aj -p50 значительно повышались через 24 часа при обработке P и OP и через 72 часа при обработке TP ( P <0,05). Относительные уровни экспрессии гена Aj -rel во всех обработках PHB значительно повышались через 24, 72 и 168 часов после инъекции инактивированного V.splendidus ( P <0,05). Между тем, относительный уровень экспрессии гена Aj -rel при обработке OP был значительно выше, чем при других обработках в каждый момент времени ( P <0,05). Относительный уровень экспрессии гена Aj -lys значительно повышался только при обработке ОП через 24 и 72 ч после введения инактивированного V. splendidus ( P < 0,05).

      Анализ кишечной микробиоты

      Бактериальное разнообразие кишечника

      В общей сложности после контроля качества и оптимизации исходных данных из 20 образцов кишечного содержимого была получена 1 022 781 валидная последовательность высокого качества, в среднем 51 139 последовательностей на образец.Последовательности варьировались от 401 до 440 п.н. со средней длиной 417 п.н. Из 20 образцов всего 2741 OTU, полученные в соответствии с 97% идентичностью последовательностей, были отнесены к 37 типам, 98 классам, 245 отрядам, 421 семейству, 858 родам и 1474 видам. Кривые разрежения имели тенденцию приближаться к плато насыщения во всех образцах, предполагая, что глубины секвенирования было достаточно, чтобы охватить все разнообразие бактерий (рис. 3А).

      Рисунок 3. Кривые разрежения и анализ диаграммы Венна кишечной микробиоты для контроля и лечения ПГБ. (A) Анализ кривых разрежения при различных обработках и (B) Диаграмма Венна. К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Диаграмма Венна показала, что четыре варианта лечения совместно использовали 85 OTU. Было 767, 161, 397 и 531 уникальных OTU в контроле, P, OP и TP соответственно (рис. 3B). Показатели альфа-разнообразия бактериального сообщества представлены в табл. 3.Анализ альфа-разнообразия показал, что богатство кишечной микробиоты при обработках P, OP и TP было значительно выше, чем в контроле ( P <0,05). Индекс chao1 при лечении OP был значительно выше, чем при лечении P и TP ( P <0,05). Индекс ACE при лечении P и OP был значительно выше, чем при лечении TP ( P <0,05). Индексы микробного разнообразия Шеннона и Симпсона при обработке ОП были значительно выше, чем при обработке ТП ( P < 0.05). Как показано на рисунке 4, ординация NMDS показала, что диетический PHB изменил структуру кишечной микробиоты, особенно лечение OP имело явно отличающиеся характерные бактериальные сообщества по сравнению с контролем.

      Таблица 3. Влияние пищевых добавок с различными уровнями ПОБ на индекс альфа-разнообразия кишечной микробиоты морских огурцов.

      Рис. 4. Анализ UniFrac методом неметрического многомерного масштабирования (NMDS) на основе расстояний кишечных микробных сообществ морских огурцов, получавших диетические добавки с различными уровнями PHB.К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Состав кишечного бактериального сообщества

      На уровне типов Proteobacteria , Bacteroidota , Firmicutes , Verrucomicrobiota и Actinobacteriota были преобладающими бактериальными типами в кишечной микробиоте трепанга (рис. 5А). Относительная численность Verrucomicrobiota (9.25%) и Dependentiae (4,81%) при обработке OP значительно увеличилось ( P <0,05) по сравнению с контролем, однако относительная численность Firmicutes при всех обработках PHB уменьшилась.

      Рисунок 5. Влияние пищевых добавок с различными уровнями ПОБ на состав микробного сообщества. (A) На уровне типа, (B) на уровне семейства и (C) на уровне рода. К (контроль): основной рацион; P: добавка к основному рациону с 0.5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      На уровне семейства Rhodobacteraceae , Moraxellaceae и Flavobacteriaceae были преобладающими бактериальными семействами в кишечной микробиоте морских огурцов (рис. 5B). Относительная численность Rhodobacteraceae была значительно увеличена при обработках P (34,56%), OP (43,29%) и TP (28,79%) по сравнению с контролем ( P <0.05). Относительная численность Halomonadaceae при обработке P (5,58%) и TP (1,66%) значительно увеличилась ( P <0,05). Относительная численность Vibrarionaceae значительно снизилась при обработках P (0,72%) и TP (0,24%) ( P <0,05), но увеличилась при обработке OP (10,14%). Кроме того, относительное обилие Rubritaleaceae и norank_o_ Babeliales в ОП (8,37% и 4,64% соответственно) и обработке ТП (2.03% и 1,31% соответственно) значительно увеличились ( P <0,05), тогда как Moraxellaceae при лечении ОП (10,04%) значительно снизились ( P <0,05).

      На уровне рода Psychrobacter , unclassified_f_ Rhodobacteraceae , Formosa , Lutibacter и Sedimentitalea были преобладающими бактериальными родами в кишечной микробиоте трепанга (рис. 5C). По сравнению с контролем относительное количество Psychrobacter при лечении ОП (9.98%) было значительно снижено ( P <0,05). Относительная численность Sedimentitales значительно увеличилась при обработке P (5,99%) и OP (6,44%) ( P <0,05). Относительная численность unclassified_f_ Rhodobacteraceae при обработке P (27,68%), OP (34,41%) и TP (24,17%) значительно увеличилась ( P <0,05), а Haloferula и norank_f_norank_o_ Babeliales значительно увеличилась. увеличивается при лечении ОП (8.29% и 4,64% соответственно) ( P < 0,05). Относительная численность Vibrio в обработках P (0,72%) и TP (0,24%) значительно снизилась ( P <0,05), а при обработке OP увеличилась (10,14%). Относительная численность Kushneria была заметно увеличена при обработке P (5,53%) ( P <0,05).

      Анализ LEfSe выявил 12 дифференциальных OTU, ответственных за различение между четырьмя вариантами лечения (рис. 6).При сравнении методов лечения один, восемь и два OTU в режимах P, OP и TP были значительно увеличены ( P <0,05) соответственно. При обработке P OTU принадлежит к семейству Rhodobacteraceae . При лечении ОП, восемь ОТА относится к бактериальному ТАКСОНОМИЧЕСКОМУ семей norank_o_ Babeliales , Rhodobacteraceae , Rhizobiaceae , unclassified_c_ гаммы-протеобактерия , unclassified_o_ Babeliales , unclassified_c_ Alphaproteobacteria , Bacillaceae и Legionellaceae .При обработке TP две OTU принадлежат к бактериальным таксономическим семействам Clostridiaceae и Rubritaleaceae . Одна OTU, принадлежащая к семейству Promicromonosporaceae , была значительно снижена при всех обработках PHB по сравнению с контролем ( P <0,05).

      Рисунок 6. Линейный дискриминантный анализ (LDA) и анализ размера эффекта (LefSe) выявили наиболее дифференциально распространенные операционные таксономические единицы (OTU) для морского огурца между контролем и обработкой PHB.К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Экологический сетевой анализ

      Четыре варианта молекулярных экологических сетей были построены на основе теории случайных матриц, красные и синие связи обозначали положительные и отрицательные взаимодействия соответственно (рис. 7). Как показано на рисунке 7 и в дополнительной таблице S1, в контрольной сети сеть была разделена на четыре модуля, состоящие из 109 узлов и 1067 ссылок (1030 положительных и 37 отрицательных взаимодействий).В варианте P сеть была разделена на шесть модулей, состоящих из 157 узлов и 1054 связей (949 положительных и 105 отрицательных взаимодействий). При обработке ОП сеть была разделена на восемь модулей, состоящих из 204 узлов и 937 связей (690 положительных и 247 отрицательных взаимодействий). При обработке TP сеть была разделена на четыре модуля, состоящие из 89 узлов и 1014 связей (987 положительных и 27 отрицательных взаимодействий). В сетях было больше узлов и более высокая доля отрицательных и положительных взаимодействий в обработке OP, чем в контроле, что указывает на более крупную и сложную экологическую сеть.Как показано в дополнительной таблице S2, сеть в контрольной группе, при лечении P, OP и TP состояла из разных OTU из 53, 73, 92 и 53 семейств соответственно. Доминирующими семействами были Bacillaceae , Flavobacteriaceae и Rhodobacteraceae .

      Рисунок 7. Сетевой анализ кишечной микробиоты морских огурцов. Каждый узел указывает один OTU. Разные цветные узлы представляют разные классы. Красная ссылка указывает на положительное взаимодействие между двумя людьми, а синяя ссылка указывает на отрицательное взаимодействие.Сеть обработки (A) C, сеть обработки (B) P, сеть обработки (C) OP и сеть обработки (D) TP. К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Индексы экологической сети обобщены в дополнительной таблице S1. Средний коэффициент кластеризации (avgCC), среднее расстояние пути (GD) и модульность эмпирических сетей значительно различались ( P < 0.001) из соответствующих им случайных сетей в каждом варианте лечения, что указывает на то, что каждая сеть лечения имеет типичное свойство малого мира и модульность (Watts and Strogatz, 1998). Кроме того, GD в обработках P (2,747), OP (5,381) и TP (2,418), avgCC в обработках OP (0,620) и TP (0,707), а также модульность в обработках P (0,482), OP (0,704). ) и TP (0,158) обработки значительно отличались от контроля ( P <0,001).

      Различные топологические роли OTU в экологических сетях показаны на рисунке 8 и в дополнительной таблице S3.Большинство OTU в четырех сетях были периферийными устройствами. Контроль, обработка P, OP и TP показали четыре, десять, два и пять OTU в качестве соединителей соответственно. Кроме того, одна OTU служила концентраторами модулей в каждой из трех обработок PHB, а одна OTU служила сетевыми концентраторами в обработке P.

      Рисунок 8. Распределение таксонов кишечных бактерий трепанга в зависимости от их топологической роли. К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Прогностические функции кишечной микробиоты

      Как показано на рисунке 9, по сравнению с контролем, десять функциональных путей (аминокислотный метаболизм, метаболизм липидов, рост и гибель клеток, метаболизм других аминокислот, метаболизм нуклеотидов, энергетический обмен, метаболизм углеводов, метаболизм терпеноидов и поликетидов, сигнальный молекулы и взаимодействие, биосинтез и метаболизм гликанов) были обогащены при обработке P ( P < 0,05), тогда как три функциональных пути (эндокринная система, сенсорная система, глобальная и обзорная карты) были значительно снижены ( P < 0 .05). При лечении ОП восемь функциональных путей (сигнальные молекулы и взаимодействие, метаболизм других аминокислот, метаболизм аминокислот, рост и гибель клеток, глобальные и обзорные карты, транспорт и катаболизм, метаболизм липидов и метаболизм нуклеотидов) были значительно выше, чем при контроль ( P < 0,05). Однако четыре функциональных пути (передача сигнала, «складывание, сортировка и деградация», старение, репликация и восстановление) были значительно снижены ( P < 0.05). При лечении ТП были обогащены восемь функциональных путей (метаболизм других аминокислот, энергетический обмен, рост и гибель клеток, метаболизм аминокислот, глобальная и обзорная карты, метаболизм липидов, транспорт и катаболизм и метаболизм нуклеотидов) ( P < 0,05). Напротив, пять функциональных путей (передача сигнала, подвижность клеток, система кровообращения, «складывание, сортировка и деградация» и лекарственная устойчивость: противомикробные) были значительно снижены ( P < 0.05).

      Рисунок 9. Различия кишечных микробных функций, предсказанные на уровне 2 путей Киотской энциклопедии генов и геномов (KEGG) с использованием PICRUSt. Показаны только данные со значительными различиями ( P <0,05) между видами лечения. (A) обработка C и P, (B) обработка C и OP, (C) обработка C и TP. К (контроль): основной рацион; Р: добавление к основному рациону 0,5% ПГБ; ОП: добавление к основному рациону 1% ПГБ; TP: добавление к основному рациону 3% ПГБ.

      Обсуждение

      Поли-β-гидроксибутират (ПГБ) является не только источником углерода, который обеспечивает энергию для роста и развития некоторых водных животных, но и расщепляется до водорастворимого мономера β-гидроксимасляной кислоты в кишечнике, который приносит пользу кишечной микробиоте (De Schryver и др., 2010; Нхан и др., 2010; Суи и др., 2012, 2016). При добавлении PHB у некоторых водных животных, таких как кефаль ( Liza haematocheila ) и тихоокеанские белые креветки L, наблюдались лучшие показатели роста.vannamei (Duan et al., 2017b; Qiao et al., 2019). В этом исследовании также было продемонстрировано значительное улучшение показателей роста морских огурцов при добавлении ПГБ. Однако подходящая доза ПГБ для эффекта стимуляции роста может зависеть от вида. Ранее сообщалось, что оптимальная стимулирующая рост доза ПГБ для китайских мохнатых крабов ( E. sinensis ), европейских морских окуней ( D. labrax ) и сибирских осетров ( A. baerii ) составляет 1–3%. (Суи и др., 2016), 2–5% (De Schryver et al., 2010) и 2% (Najdegerami et al., 2012) соответственно. Для сравнения, в этом исследовании удельные темпы роста морских огурцов, получавших рацион с добавлением 0,5% и 1% ПГБ, были значительно выше, чем у 3% ПГБ, что указывает на то, что стимулирующий эффект ПГБ на показатели роста зависит от дозы и видоспецифичны для водных животных (De Schryver et al., 2010; Ng, Koh, 2017).

      Целомоциты могут выделять бактерицидные гуморальные факторы и поглощать инвазивные патогенные микроорганизмы.Поэтому они являются важным барьером в системе неспецифического иммунитета трепангов (Zhao et al., 2012). Как правило, для оценки неспецифической иммунной способности водных животных используется ряд параметров, включая респираторный взрыв, фагоцитоз, активность SOD, CAT, ACP, AKP и LZM (Adeshina et al., 2021; Guo et al. , 2021; Джанг и др., 2021). В этом исследовании реакция неспецифических иммунных параметров на добавку ПОБ явно зависела от дозы. Введение в рацион 1% ПОБ значительно улучшало все показатели целомоцитов трепанга.Однако при лечении P (0,5%) не наблюдалось повышения активности CAT и LZM, а при лечении TP (3%) появлялось только повышение активности CAT. Для сравнения, Duan et al. (2017b) обнаружили, что пищевые добавки с 3% ПГБ значительно повышали активность LZM в кишечнике у тихоокеанских белых креветок L. vannamei . В другом исследовании, вопреки нашим выводам, диетический PHB значительно снижал активность ACP и AKP в гемолимфе китайских мохнатых крабов (Sui et al., 2016). Эти результаты свидетельствуют о том, что реакция неспецифических иммунных параметров на добавку ПОБ также была дозозависимой и видоспецифичной у водных животных.

      Кишечник является важным местом переваривания пищи и всасывания питательных веществ, а также важнейшим барьером для защиты врожденной иммунной системы от патогенных микроорганизмов (Li et al., 2020). NF-κB играет важную роль в воспалении, иммунном ответе, развитии и дифференцировке (Hoffmann and Baltimore, 2006). Ван и др. (2013) идентифицировали три важных иммунных гена в сигнальном пути NF-κB морского огурца: Aj -p105, Aj -p50 и Aj -rel.Между тем сигнальный каскад NF-κB был активен у трепангов и играл решающую роль в регуляции иммунного ответа (Wang et al., 2013). Лизоцим лизирует патогенные бактерии, проникшие в организм. Следовательно, уровень экспрессии мРНК Aj -pl05, Aj -p50, Aj -rel и Aj -lys в кишечнике может отражать иммунный статус A. japonicus (Yang et al. ., 2015а; Ахмадифар и др., 2019). В настоящем исследовании диетический PHB повышал уровни экспрессии этих четырех генов в различной степени.Это указывало на то, что диетический PHB стимулировал экспрессию кишечных генов, связанных с иммунитетом, и усиливал трансдукцию сигнального пути NF-κB. Среди трех видов лечения показатели ОП были значительно выше, чем при других видах лечения.

      Для оценки влияния ПОБ на кишечный иммунный ответ A. japonicus кишечный иммунный ответ A. japonicus стимулировали с помощью инактивированного V. splendens и относительных уровней экспрессии Aj Гены -pl05, Aj -p50, Aj -rel и Aj -lys сравнивали до и после стимуляции в этом исследовании.Уровни экспрессии четырех иммунозависимых генов при лечении OP значительно быстро повышались через 24 часа после инъекции инактивированного V. splendens и все еще выше, чем в контроле, через 72 и 168 часов. Это указывало на то, что правильная концентрация ПОБ усиливала иммунную функцию кишечника A. japonicus и ускоряла его иммунный ответ на стресс для повышения устойчивости к патогенным бактериям.

      Добавка PHB изменила богатство, разнообразие и состав кишечной микробиоты морских огурцов в настоящем исследовании.Микробное богатство трех препаратов с добавками PHB было значительно выше, чем в контроле. Кроме того, влияние ПОБ на микробное богатство было дозозависимым. Микробная насыщенность кормов с добавками 0,5 и 1 % ПОБ была значительно выше, чем с 3 %. С другой стороны, индексы Шеннона и Симпсона при лечении ОП были самыми высокими. Появилась значительная разница в микробной структуре кишечника между обработкой ОП и контролем с помощью NMDS. Анализ LEfSe выявил 12 дифференциальных OTU, ответственных за различение между четырьмя видами лечения.Восемь из 12 OTU наблюдались при лечении OP, и их количество значительно увеличилось по сравнению с другими методами лечения. Эти результаты показали, что кишечное сообщество при обработке ОП имело другие характеристики, чем в контроле, что указывает на явное регулирующее влияние 1% ПОБ на микробную структуру кишечника трепанга.

      Микробиота кишечника морских огурцов изменилась после приема добавки ПОБ. Было обнаружено, что относительное количество Rhodobacteracea при лечении добавками PHB значительно увеличилось; этот результат хорошо подтвердил наше предположение. Rhodobacteraceae — важный игрок в морской экосистеме (Daniel et al., 2018). Предыдущие исследования показали, что Rhodobacteraceae играет активную роль в поддержании здоровья и ускорении роста некоторых водных животных, в том числе тихоокеанской белой креветки L. vannamei (Zheng et al., 2017; Liu et al., 2019; Wang et al. ., 2020), краб Portunus trituberculatus (Lu et al., 2022), атлантический лосось ( Salmo salar L.) (Hartviksen et al., 2014) и сумеречный коб Argyrosomus japonicus (Maapea et al., 2021). В этом исследовании самая высокая относительная численность Rhodobacteraceae наблюдалась при обработке OP, за которой следует обработка P и TP, которая была самой низкой среди трех обработок PHB. Анализ LEfSe выявил два биомаркера, принадлежащих к Rhodobacteraceae , со значительно увеличенным содержанием при обработке P (OTU1455) и OP (OTU2035). Этот результат хорошо согласовывался с тенденцией к усилению роста морских огурцов, получавших ПГБ, указывая на то, что усиление показателей роста морских огурцов может быть тесно связано с увеличением относительной численности Rhodobacteraceae .Любопытно, что относительное количество Vibrio при обработке OP было увеличено, а при обработке P и TP значительно уменьшилось. Vibrio – обычная бактерия в кишечнике морских беспозвоночных, т.е. он был преобладающим видом в кишечнике A. japonicus (Wang et al., 2018; Zhao et al., 2018). Однако обычно он считается условно-патогенным микроорганизмом в аквакультуре (Thompson et al., 2004). В настоящем исследовании увеличение относительной численности Vibrio при обработке ОП не оказало отрицательного влияния на голотурий.Напротив, показатели роста и неспецифический иммунитет трепангов при обработке ОП были лучше, чем при других обработках. Хотя некоторые вид Vibrio считались связанными с болезнями, сообщалось, что некоторые вид Vibrio являются полезными (Ninawe and Selvin, 2009). Полезный Vibrio может ингибировать рост патогенных бактерий или непосредственно убивать патогенные микроорганизмы, и они могут вносить основной вклад в усвояемость питательных веществ (Rajeev et al., 2021). Несколько видов Vibrio успешно применялись в качестве агентов биоконтроля в аквакультуре (Thompson et al., 2004; Gao et al., 2014). Можно предположить, что добавление 1% ПГБ может надлежащим образом снизить рН кишечника, создать благоприятную среду для благоприятного роста полезных Vibrio и ингибировать рост патогенных Vibrio spp. (Дуан и др., 2017а). Кроме того, относительная численность Verrucomicrobiota и Rubritaleaceae при обработке ОП значительно увеличилась, а численность Moraxellaceae значительно снизилась.Первые два могли играть важную роль в деградации полисахаридов, а второй рассматривался как класс условно-патогенных бактерий или патобионтов (Embers et al., 2011; Cardman et al., 2014; Teixeira, Merquior, 2014; Ruzauskas et al. ., 2021). Приведенные выше результаты свидетельствуют о том, что добавка ПГБ изменила микробиоту кишечника, что может способствовать росту полезных бактерий и ингибировать патогенные.

      Положительные (такие как мутуализм или синергия) и отрицательные взаимодействия (такие как конкуренция или хищничество) межвидовых взаимодействий внутри кишечного микробного сообщества создают сложную экологическую сеть и поддерживают стабильность кишечной микробной экосистемы (Deng et al., 2012; Койт и др., 2015; Сюн и др., 2017; Вентурелли и др., 2018). Как правило, сотрудничающие сети микробов могут быть эффективными, но обычно они нестабильны, и хозяева могут извлекать выгоду из микробной конкуренции, когда микробная конкуренция ослабляет сотрудничающие сети и повышает стабильность (Coyte et al., 2015). В настоящем исследовании более крупная и сложная экологическая сеть наблюдалась при обработке ОП с наибольшим соотношением негативных/положительных взаимодействий и наибольшей средней дистанцией пути.Это указывает на то, что добавление 1% ПГБ может повысить стабильность кишечной микробной экосистемы. Между тем, топологический ролевой анализ показал, что в варианте P больше разъемов и концентраторов модулей, чем в других вариантах. С экологической точки зрения, коннекторы и концентраторы модулей могут быть связаны с универсалами, в то время как уменьшение универсальности может привести к ухудшению состояния сети (Olesen et al., 2007; Kaiser-Bunbury et al., 2010; Ramos-Jiliberto et al., 2012). ). Таким образом, добавка 0,5% ПГБ также может быть полезной для повышения стабильности кишечной микробной экосистемы.Значение модульности можно использовать для измерения того, насколько хорошо сеть может быть разделена на модули. Каждый сетевой модуль считается функциональной единицей и выполняет идентифицируемую задачу (Newman, 2006; Deng et al., 2012). В этом исследовании сеть в вариантах P (модульность 0,482, 6 субмодулей) и OP (модульность 0,704, 8 субмодулей) имела более высокую модульность и большее количество субмодулей, чем лечение TP (модульность 0,158, 4 субмодуля). ) и контрольный (модульность 0,286, 4 подмодуля). Эти результаты показали, что 0.Добавки 5% и 1% PHB могли лучше регулировать микробиоту кишечника для выполнения большего количества биологических функций, а доза 1% PHB была лучше, чем добавка 0,5%.

      Кишечная микробиота играет важную роль в метаболизме и усвоении питательных веществ (Ramakrishna, 2013). Благодаря метаболическим путям, связанным с аминокислотами, кишечная микробиота может производить некоторые аминокислоты, поглощаемые кишечником хозяина в качестве питательных веществ (Bairagi et al., 2002; Pandiyan et al., 2013). Более того, кишечная микробиота может играть иммуномодулирующую роль, регулируя метаболизм липидов (Liang et al., 2021). Следовательно, метаболическая активность кишечной микробиоты тесно связана со здоровьем хозяина (Shortt et al., 2018; Rastelli et al., 2019). В настоящем исследовании предсказанные функции кишечной микробиоты показали, что десять, восемь и восемь функциональных путей при лечении P, OP и TP значительно усиливаются соответственно. Метаболизм аминокислот, метаболизм липидов и метаболизм нуклеотидов при всех обработках PHB значительно увеличился. В настоящем исследовании усиление множественных метаболических функций кишечной микробиоты может непосредственно улучшить показатели роста и активность неспецифических иммунных ферментов у A.японский . Общее улучшение богатства и разнообразия кишечной микробиоты может позволить большему количеству бактерий процветать в микробном сообществе (Sui et al., 2016). В частности, что касается изменений в микробиоте кишечника, относительное количество Rhodobacteriaceae при всех обработках PHB было значительно увеличено. Бактерии Rhodobacteraceae обладают сложными метаболическими путями и выполняют различные экологические функции в морских экосистемах (Luo and Moran, 2014; Simon et al., 2017). Кроме того, в предыдущих исследованиях сообщалось, что некоторые вторичные метаболиты Rhodobacteraceae обладают потенциальным ингибирующим действием на патогены рыб (Sonnenschein et al., 2017). Таким образом, увеличение относительной численности Rhodobacteraceae может частично способствовать усилению путей метаболизма при лечении ПГБ.

      Однако стоит отметить, что три функциональных пути в обработке P (эндокринная система, сенсорная система, глобальная и обзорная карты), четыре функциональных пути в обработке OP (передача сигнала, «складывание, сортировка и деградация», репликация и репарация , старение), и пять функциональных путей при лечении TP (передача сигнала, подвижность клеток, система кровообращения, «складывание, сортировка и деградация», лекарственная устойчивость: противомикробная) значительно снизились.В целом количество усиленных функциональных путей уменьшалось, а число ослабленных функциональных путей увеличивалось с увеличением дозы ПОБ. Это предполагает, что эффекты ПОБ на функциональные пути кишечной микробиоты также были дозозависимыми, более высокие дозы вместо этого уменьшали эффекты усиления функциональных путей.

      Заключение

      Это исследование продемонстрировало, что пищевые добавки с PHB значительно стимулировали рост, повышали активность неспецифических иммунных ферментов, стимулировали экспрессию генов, связанных с иммунитетом в кишечнике, и усиливали трансдукцию сигнального пути NF-κB в A.японский . Пищевые добавки с 1% PHB показали лучшее благотворное влияние на активность неспецифических иммунных ферментов и экспрессию генов, связанных с иммунитетом, у A. japonicus . Добавка PHB увеличила богатство кишечной микробиоты. Существенное регулирующее влияние на микробную структуру кишечника A. japonicus проявлялось при 1 % ПОБ, а стабильность кишечных экологических сетей значительно обогащалась при 0,5 и 1 % ПОБ. Диетический ПОБ значительно усиливал функции метаболических путей кишечной микробиоты.Увеличение относительной численности Rhodobacteraceae может частично улучшить показатели роста и иммунные реакции, а также пути метаболизма кишечной микробиоты A. japonicus . Когда характеристики роста, иммунитет, структура и прогнозируемые функции кишечной микробиоты рассматривались вместе, 1% ( w / w ) PHB является оптимальной дозой в качестве кормовой добавки для морского огурца.

      Заявление о доступности данных

      Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях.Названия репозитория/репозиториев и номер(а) доступа можно найти ниже: NCBI (инвентарный номер: PRJNA781084).

      Заявление об этике

      Все эксперименты на животных проводились в соответствии с рекомендациями и одобрением соответствующих комитетов по исследованиям и этике животных Океанического университета Китая (номер разрешения: 20141201. http://www.gov.cn/gongbao/content/2011/content_1860757. хтм).

      Вклад авторов

      LL провела эксперименты, проанализировала данные и написала рукопись.MW, CW, YL, MP, SW и LC помогали LL в сборе и уходе за животными. XT был главным инструктором. Все авторы внесли свой вклад в статью и одобрили представленную версию.

      Финансирование

      Эта работа выполнена при финансовой поддержке Национального фонда естественных наук Китая (41976095) и Шаньдунского фонда естественных наук (ZR2017MC027).

      Конфликт интересов

      Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

      Примечание издателя

      Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов. Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

      Благодарности

      Авторы выражают благодарность Лаборатории экологии аквакультуры Океанического университета Китая за поддержку.

      Дополнительный материал

      Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmars.2022.855938/full#supplementary-material

      .

      Сноски

      Каталожные номера

      Адешина И., Абдель-Тавваб М., Тиджани З. А., Тиамию Л. О. и Джаханбахши А. (2021). Диетический экстракт листьев Tridax procumbens стимулировал рост, антиоксиданты, иммунитет и устойчивость нильской тиляпии , Oreochromis niloticus к моногенным паразитарным инфекциям. Аквакультура 532:736047. doi: 10.1016/j.aquaculture.2020.736047

      Полнотекстовая перекрестная ссылка | Академия Google

      Ахмадифар, Э., Давуд, М.А.О., Могхадам, М.С., Шейхзаде, Н., Хосейнифар, С.Х., и Мустафа, М.С. (2019). Модуляция иммунных параметров и антиоксидантной защиты у рыбок данио ( Danio rerio ) с использованием диетического яблочного уксуса. Аквакультура 513:734412. doi: 10.1016/j.aquaculture.2019.734412

      Полнотекстовая перекрестная ссылка | Академия Google

      Байраги А., Гош, К.С., Кумар, С., Сен, С.К., и Рэй, А.К. (2002). Фермент-продуцирующая бактериальная флора, выделенная из пищеварительного тракта рыб. Аквакульт. Междунар. 10, 109–121. дои: 10.1023/A:1021355406412

      Полнотекстовая перекрестная ссылка | Академия Google

      Bolyen, E., Rideout, J.R., Dillon, M.R., Bokulich, N.A., Abnet, C.C., Al-Ghalith, G.A., et al. (2019). Воспроизводимая, интерактивная, масштабируемая и расширяемая наука о микробиомах с использованием QIIME 2. Nat. Биотехнолог. 37, 852–857.doi: 10.1038/s41587-019-0209-9

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Кабельо, ФК (2006). Интенсивное профилактическое использование антибиотиков в аквакультуре: растущая проблема для здоровья людей и животных, а также для окружающей среды. Окружающая среда. микробиол. 8, 1137–1144. doi: 10.1111/j.1462-2920.2006.01054.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Кардман З., Арности К., Дурбин А., Зиерфогель К., Кокс К., Стин А.Д. и др. (2014). Verrucomicrobia являются кандидатами на роль разлагающего полисахариды бактериопланктона в арктическом фьорде на Шпицбергене. Заяв. Окружающая среда. микробиол. 80, 3749–3756. doi: 10.1128/AEM.00899-14

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Клайн, М.С., Смут, М., Черами, Э., Кучински, А., Лэндис, Н., Уоркман, К., и соавт. (2007). Интеграция биологических сетей и данных об экспрессии генов с помощью Cytoscape. Нац. протокол 2, 2366–2382.doi: 10.1038/nprot.2007.324

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Дас А., Саха Д. и Пал Дж. (2009). Устойчивость к противомикробным препаратам и перенос генов in vitro у бактерий, выделенных из язв рыб, пораженных EUS, в Индии. Письмо. заявл. микробиол. 49, 497–502. doi: 10.1111/j.1472-765X.2009.02700.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Де Шрайвер П., Синха А. К., Кунвар П. С., Баруа К., Verstraete, W., Boon, N., et al. (2010). Поли-β-гидроксибутират (ПГБ) повышает показатели роста и обогащенность кишечными бактериями по диапазону взвешенных значений у молоди европейского морского окуня, Dicentrarchus labrax . Заяв. микробиол. Биотехнолог. 86, 1535–1541. doi: 10.1007/s00253-009-2414-9

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Дефойрдт, Т., Бун, Н., Соргелос, П., Верстрате, В., и Боссье, П. (2007). Альтернативы антибиотикам для борьбы с бактериальными инфекциями: на примере люминесцентного вибриоза в аквакультуре. Тенденции биотехнологии. 25, 472–479. doi: 10.1016/j.tibtech.2007.08.001

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Дэн Ю., Цзян Ю. Х., Ян Ю., Хе З., Ло Ф. и Чжоу Дж. (2012). Анализ молекулярных экологических сетей. Биоинформатика BMC 13:113. дои: 10.1186/1471-2105-13-113

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Дуань Ю., Чжан Ю., Донг Х., Ван Ю. и Чжан Дж. (2017a). Влияние диетического поли-β-гидроксибутирата (ПГБ) на состав микробиоты и сигнальный путь mTOR в кишечнике litopenaeus vannamei . J. Microbiol. 55, 946–954. doi: 10.1007/s12275-017-7273-y

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Duan, Y., Zhang, Y., Dong, H., Zheng, X., Wang, Y., Li, H., et al. (2017б). Влияние диетического поли-β-гидроксибутирата (ПГБ) на показатели роста, состояние здоровья кишечника и состав тела тихоокеанской белой креветки Litopenaeus vannamei (Boone, 1931). Иммунол рыбных моллюсков. 60, 520–528. doi: 10.1016/j.fsi.2016.11.020

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Эмберс, М.Е., Дойл, Л.А., Уайтхаус, К.А., Селби, Э.Б., Чаппелл, М., и Филипп, М.Т. (2011). Характеристика вида Moraxella , вызывающего носовое кровотечение у макак. Вет. микробиол. 147, 367–375. doi: 10.1016/j.vetmic.2010.06.029

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Гао Ф., Тан Дж., Сунь Х. и Ян Дж. (2014). Бактериальное разнообразие содержимого кишечника морского огурца ( Apostichopus japonicus ) и поверхностных отложений его среды обитания. J. Ocean Univ. Китай 13, 303–310. doi: 10.1007/s11802-014-2078-7

      Полнотекстовая перекрестная ссылка | Академия Google

      Гао, М., Ду, Д., Бо, З., и Суи, Л. (2019). Галомонады, накапливающие поли-β-гидроксибутират (ПГБ), улучшают выживаемость, рост, устойчивость и изменяют микробный состав кишечника постличинок Litopenaeus vannamei . Аквакультура 500, 607–612. doi: 10.1016/j.aquaculture.2018.10.032

      Полнотекстовая перекрестная ссылка | Академия Google

      Го, К., Чжао З., Луо Л., Ван С., Чжан Р., Сюй В. и др. (2021). Реакция иммунной и кишечной микробиоты на стресс от воздействия воздуха у китайского мохнатого краба ( Eriocheir sinensis ). Аквакультура 541:736833. doi: 10.1016/j.aquaculture.2021.736833

      Полнотекстовая перекрестная ссылка | Академия Google

      Halet, D., Defoirdt, T., Van Damme, P., Vervaeren, H., Forrez, I., Van de Wiele, T., et al. (2007). Бактерии, накапливающие поли-β-гидроксибутират, защищают гнотобиотик Artemia franciscana от патогенного Vibrio campbellii . FEMS микробиол. Экол. 60, 363–369. doi: 10.1111/j.1574-6941.2007.00305.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Хартвиксен М., Весино Дж. Л. Г., Ринго Э., Бакке А. М., Уодсворт С., Крогдал А. и соавт. (2014). Альтернативные источники диетического белка для атлантического лосося ( Salmo salar L.) влияют на кишечную микробиоту, гистологию и рост кишечника и печени. Аква. Нутр. 20, 381–398. doi: 10.1111/anu.12087

      Полнотекстовая перекрестная ссылка | Академия Google

      Хуанг, Л., Guo, H., Chen, C., Huang, X., Chen, W., Bao, F., et al. (2020). Бактерии из крупных биофлоков больше связаны с микробиотой кишечника креветок в системе культивирования. Аквакультура 523:735159. doi: 10.1016/j.aquaculture.2020.735159

      Полнотекстовая перекрестная ссылка | Академия Google

      Хунг, Н. В., Де Шрайвер, П., Тэм, Т. Т., Гарсия-Гонсалес, Л., Боссье, П., и Неведжан, Н. (2015). Применение поли-β-гидроксибутирата (ПГБ) в выращивании личинок мидий. Аквакультура 446, 318–324.doi: 10.1016/j.aquaculture.2015.04.036

      Полнотекстовая перекрестная ссылка | Академия Google

      Jang, W.J., Hasan, M.T., Lee, G.H., Lee, B.J., Hur, S.W., Lee, S., et al. (2021). Сравнение споровых или вегетативных Bacillus sp. добавки на физиологические изменения и микробиоту кишечника оливковой камбалы ( Paralichthys olivaceus ). Аквакультура 535:736355. doi: 10.1016/j.aquaculture.2021.736355

      Полнотекстовая перекрестная ссылка | Академия Google

      Ендроссек, Д.и Пфайффер, Д. (2014). Новое понимание образования полигидроксиалканоатных гранул (карбоносом) и новых функций поли(3-гидроксибутирата). Окружающая среда. микробиол. 16, 2357–2373. дои: 10.1111/1462-2920.12356

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Кайзер-Банбери, С. Н., Мафф, С., Меммотт, Дж., Мюллер, С. Б., и Кафлиш, А. (2010). Устойчивость сетей опыления к потере видов и взаимодействию: количественный подход, учитывающий поведение опылителей. Экол. лат. 13, 442–452. doi: 10.1111/j.1461-0248.2009.01437.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Langille, M.G., Zaneveld, J., Caporaso, J.G., McDonald, D., Knights, D., Reyes, J.A., et al. (2013). Прогностическое функциональное профилирование микробных сообществ с использованием последовательностей маркерных генов 16S рРНК. Нац. Биотехнолог. 31, 814–821. doi: 10.1038/nbt.2676

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Ли, Ю., Yang, Y., Ji, Q., Song, J., Wang, L., Liu, B., et al. (2020). Функция каталазы Apostichopus japonicas в кишечном иммунитете морского огурца. Аквакультура 521:735103. doi: 10.1016/j.aquaculture.2020.735103

      Полнотекстовая перекрестная ссылка | Академия Google

      Лян, К., Донг, Дж., Ван, С., Шао, В., Ахмед, А.Ф., Чжан, Ю., и др. (2021). Иммуномодулирующие эффекты полисахаридов семян Nigella sativa с помощью кишечных микробных и протеомных технологий. Междунар. Дж. Биол. макромол. 184, 483–496. doi: 10.1016/j.ijbiomac.2021.06.118

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Лю Дж., Ван К., Ван Ю., Чен В., Джин З., Яо З. и др. (2019). Штамм-специфические изменения профилей микробиоты кишечника белой креветки Litopenaeus vannamei в ответ на холодовой стресс. Аквакультура 503, 357–366. doi: 10.1016/j.aquaculture.2019.01.026

      Полнотекстовая перекрестная ссылка | Академия Google

      Лю, Ю., De Schryver, P., Van Delsen, B., Maignien, L., Boon, N., Sorgeloos, P., et al. (2010). Бактерии, разлагающие ПОБ, выделенные из желудочно-кишечного тракта водных животных, как субъекты защиты от люминесцентного вибриоза. FEMS микробиол. Экол. 74, 196–204. doi: 10.1111/j.1574-6941.2010.00926.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Лопес, Г. Р., и Левинтон, Дж. С. (1987). Экология депонирующих животных в морских отложениях. В.преподобный биол. 62, 235–260. дои: 10.1086/415511

      Полнотекстовая перекрестная ссылка | Академия Google

      Лу, З., Рен, З.М., Лин, В., Ши, К., Му, К., Ван, К., и другие. (2022). Последовательность, источники и сборка бактериального сообщества в микробиоме развивающейся личинки краба. Аквакультура 548:737600. doi: 10.1016/j.aquaculture.2021.737600

      Полнотекстовая перекрестная ссылка | Академия Google

      Маапеа, А. Д., Вайн, Н. Г., и Мейси, Б. М. (2021). Бактериальный микробиом яиц темных кобов Argyrosomus japonicus и воды для выращивания, а также бактериостатический эффект выбранных дезинфицирующих средств. Аквакультура 542:736882. doi: 10.1016/j.aquaculture.2021.736882

      Полнотекстовая перекрестная ссылка | Академия Google

      Найдегерами, Э. Х., Тран, Т. Н., Дефойрдт, Т., Марзорати, М., Соргелос, П., Бун, Н., и соавт. (2012). Влияние поли-β-гидроксибутирата (ПГБ) на продуктивность молоди сибирского осетра ( Acipenser baerii ) и микробное сообщество его желудочно-кишечного тракта. FEMS микробиол. Экол. 79, 25–33. doi: 10.1111/j.1574-6941.2011.01194.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Ng, WK, and Koh, CB (2017). Использование и механизм действия органических кислот в кормах культивируемых водных животных. Рев. Аквакульт. 9, 342–368. doi: 10.1111/raq.12141

      Полнотекстовая перекрестная ссылка | Академия Google

      Нхан, Д. Т., Вилле, М., Де Шрайвер, П., Дефойрд, Т., Боссье, П., и Соргелос, П. (2010). Влияние поли-β-гидроксибутирата на разведение личинок гигантской пресноводной креветки Macrobrachium rosenbergii . Аквакультура 302, 76–81. doi: 10.1016/j.aquaculture.2010.02.011

      Полнотекстовая перекрестная ссылка | Академия Google

      Олесен, Дж. М., Баскомпт, Дж., Дюпон, Ю. Л., и Джордано, П. (2007). Модульность сетей опыления. Проц. Натл. акад. науч. США 104, 19891–19896. doi: 10.1073/pnas.0706375104

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Пандиян П., Балараман Д., Тирунавуккарасу Р., Джордж Э. Г. Дж., Субараманиян К., Маниккам С. и др. (2013). Пробиотики в аквакультуре. Изобретение лекарства. Сегодня 5, 55–59. doi: 10.1016/j.dit.2013.03.003

      Полнотекстовая перекрестная ссылка | Академия Google

      Паркс, Д. Х., Тайсон, Г. В., Хугенхольц, П., и Бейко, Р. Г. (2014). STAMP: статистический анализ таксономических и функциональных профилей. Биоинформатика 30, 3123–3124. doi: 10.1093/биоинформатика/btu494

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Цяо, Г., Sun, Q., Zhang, M., Xu, C., Lv, T., Qi, Z., et al. (2019). Антиоксидантная система кефали сойни ( Liza haematocheila ) реагирует на пищевые добавки поли-β-гидроксибутирата (ПГБ) на основе иммунозависимой ферментной активности и анализа транскриптома de novo. Иммунол рыбных моллюсков. 95, 314–327. doi: 10.1016/j.fsi.2019.10.042

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Раджив Р., Адитья К.К., Киран Г.С. и Селвин Дж. (2021).Здоровый микробиом: ключ к успешной и устойчивой аквакультуре креветок. Рев. Аквакульт. 13, 238–258. doi: 10.1111/raq.12471

      Полнотекстовая перекрестная ссылка | Академия Google

      Рамос-Хилиберто, Р., Вальдовинос, Ф.С., Муассет де Эспанес, П., и Флорес, Д.Д. (2012). Топологическая пластичность увеличивает надежность мутуалистических сетей. Дж. Аним. Экол. 81, 896–904. doi: 10.1111/j.1365-2656.2012.01960.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Рузаускас, М., Armalyte, J., Lastauskiene, E., Siugzdiniene, R., Klimiene, I., Mockeliunas, R., et al. (2021). Профили микробной и противомикробной резистентности микробиоты обыкновенного карпа ( Cyprinus carpio ) из ​​аквакультурных и диких популяций рыб. Животные (Базель) 11:929. дои: 10.3390/ani11040929

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Сапкота А., Сапкота А. Р., Кучарски М., Берк Дж., Маккензи С., Уокер П. и др. (2008). Практика аквакультуры и потенциальные риски для здоровья человека: текущие знания и будущие приоритеты. Окружающая среда. Междунар. 34, 1215–1226. doi: 10.1016/j.envint.2008.04.009

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Шорт С., Хассельвандер О., Мейньер А., Наута А., Фернандес Э. Н., Путц П. и соавт. (2018). Систематический обзор влияния кишечной микробиоты на отдельные питательные и непитательные вещества. евро. Дж. Нутр. 57, 25–49. doi: 10.1007/s00394-017-1546-4

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Саймон, М., Scheuner, C., Meier-Kolthoff, J.P., Brinkhoff, T., Wagner-Dobler, I., Ulbrich, M., et al. (2017). Филогеномика Rhodobacteraceae показывает эволюционную адаптацию к морской и неморской среде обитания. ISME J. 11, 1483–1499. doi: 10.1038/ismej.2016.198

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Sonnenschein, E.C., Nielsen, K.F., D’Alvise, P., Porsby, C.H., Melchiorsen, J., Heilmann, J., et al. (2017). Глобальное распространение и гетерогенность видов рода Roseobacter Ruegeria mobilis . ISME J. 11, 569–583. doi: 10.1038/ismej.2016.111

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Суй, Л., Кай, Дж., Сан, Х., Вилле, М., и Боссье, П. (2012). Влияние поли-β-гидроксибутирата на китайского мохнатого краба, Eriocheir sinensis , личинок, зараженных патогенным Vibrio anguillarum . Дж. Фиш Дис. 35, 359–364. doi: 10.1111/j.1365-2761.2012.01351.x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Суй, Л., Ма, Г., Лу, В., Денг, Ю., Боссье, П., и Де Шрайвер, П. (2016). Влияние поли-β-гидроксибутирата на рост, активность ферментов и кишечное микробное сообщество молоди китайского мохнатого краба, Eriocheir sinensis (Milne-Edwards). Аква. Рез. 47, 3644–3652. doi: 10.1111/are.12817

      Полнотекстовая перекрестная ссылка | Академия Google

      Тейшейра, Л. М., и Меркиор, В. Л. К. (2014). «Семейство Moraxella ceae», в The Prokaryotes , eds E.Розенберг, Э. Ф. Делонг, С. Лори, Э. Стакебрандт и Ф. Томпсон (Берлин: Springer), 443–476. дои: 10.1007/978-3-642-38922-1_245

      Полнотекстовая перекрестная ссылка | Академия Google

      Venturelli, O.S., Carr, A.V., Fisher, G., Hsu, R.H., Lau, R., Bowen, B.P., et al. (2018). Расшифровка микробных взаимодействий в синтетических сообществах кишечного микробиома человека. Мол. Сист. биол. 14:e8157. doi: 10.15252/msb.20178157

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Ван, Л., Zhao, X., Xu, H., Bao, X., Liu, X., Chang, Y., et al. (2018). Характеристика бактериального сообщества в различных отделах кишечника трепанга ( Apostichopus Japonicus ) и его изменчивость при регенерации кишечника. Аква. Рез. 49, 1987–1996 гг. doi: 10.1111/are.13654

      Полнотекстовая перекрестная ссылка | Академия Google

      Ван Т., Сунь Ю., Джин Л., Такер П., Ли С. и Сюй Ю. (2013). Aj-rel и Aj-p105, два эволюционно консервативных гомолога NF-κB у морского огурца ( Apostichopus japonicus ), и их участие в индуцированном ЛПС иммунитете. Иммунол рыбных моллюсков. 34, 17–22. doi: 10.1016/j.fsi.2012.09.006

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Ван Ю., Ван К., Хуанг Л., Донг П., Ван С., Чен Х. и др. (2020). Мелкомасштабные закономерности сукцессии и механизмы сборки бактериального сообщества личинок Litopenaeus vannamei на протяжении цикла развития. Микробиом 8:106. doi: 10.1186/s40168-020-00879-w

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Сюн, Дж., Дай В., Чжу Дж., Лю К., Донг К. и Цю К. (2017). Основные экологические процессы микробиоты кишечника при совместном проживании отсталых, переросших и нормальных креветок. Микроб. Экол. 73, 988–999. doi: 10.1007/s00248-016-0910-x

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Yamazaki, Y., Meirelles, P.M., Mino, S., Suda, W., Oshima, K., Hattori, M., et al. (2016). Индивидуальный фекальный микробиом Apostichopus japonicus обнаруживает связь с продуцентами полигидроксибутирата в промежутках роста хозяина. Науч. Респ. 6:21631. дои: 10.1038/srep21631

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Ян Г., Тянь К., Донг С., Пэн М. и Ван Д. (2015a). Влияние пищевых добавок Bacillus cereus G19, B. cereus BC-01 и Paracoccus marcusii DB11 на рост, иммунный ответ и экспрессию иммунозависимых генов в целомоцитах и ​​кишечнике морского огурца ( Apostichopus japonicus Селенка). Иммунол рыбных моллюсков. 45, 800–807. doi: 10.1016/j.fsi.2015.05.032

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Ян Г., Сюй З., Тянь С., Донг С. и Пэн М. (2015b). Кишечная микробиота и иммунные гены у морского огурца ( Apostichopus japonicus ) реагируют на пищевые добавки β-глюкана. Биохим. Биофиз. Рез. коммун. 458, 98–103. doi: 10.1016/j.bbrc.2015.01.074

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Чжан, Дж., Шишацкая Е.И., Волова Т.Г., да Силва Л.Ф. и Чен Г.К. (2018). Полигидроксиалканоаты (PHA) для терапевтического применения. Матер. науч. англ. С 86, 144–150. doi: 10.1016/j.msec.2017.12.035

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Чжао Ю., Юань Л., Ван Дж., Сунь Х., Ван Ю. и Чжан К. (2018). Влияние потенциального автохтонного пробиотика Bacillus subtilis 2-1 на рост и кишечную микробиоту ювенильного трепанга, Apostichopus japonicus Selenka. J. Ocean Univ. Китай 17, 363–370. doi: 10.1007/s11802-018-3402-4

      Полнотекстовая перекрестная ссылка | Академия Google

      Чжао Ю., Чжан В., Сюй В., Май К., Чжан Ю. и Люфу З. (2012). Влияние потенциального пробиотика Bacillus subtilis T13 на рост, иммунитет и устойчивость к болезням против инфекции Vibrio splendidus у молоди морского огурца Apostichopus japonicus . Иммунол рыбных моллюсков. 32, 750–755. doi: 10.1016/j.фси.2012.01.027

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      Чжэн, Ю., Ю, М., Лю, Дж., Цяо, Ю., Ван, Л., Ли, З., и др. (2017). Бактериальное сообщество, связанное со здоровыми и больными личинками тихоокеанской белой креветки ( Litopenaeus vannamei ) и выращиванием воды на разных стадиях роста. Front Microbiol 8:1362. doi: 10.3389/fmicb.2017.01362

      Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

      .
Posted in Разное

Добавить комментарий

Ваш адрес email не будет опубликован.