Дезинфицирующие средства в сравнении: Сравнение активных дезинфицирующих средств и методов

Дезинфицирующие средства в сравнении: Сравнение активных дезинфицирующих средств и методов

23.03.1990

Содержание

Дезинфекция: сравнение Нокоспрей и Глосейр

Сравнительные характеристики французских  аппаратов для аэрозольной дезинфекции воздуха и поверхностей Нокоспрей и Глосейр.

Общие характеристики  аппаратов:

Действие обоих распылителей основано на разрушении клеток ионом гидроксила, образующимся из пероксида водорода в аэрозоле. Действующее вещество — пероксид водорода 6%, ионы серебра. Обе технологии предназначены для устранения в помещении возбудителей инфекций бактериальной, вирусной, грибной природы.

Необходимость дополнительных процедур после применения устройства отсутствует, так как в обработанном помещении не остается опасных  соединений.

Во время процесса дезинфекции помещения обязательным условием является отсутствие людей.

А теперь о различиях:

Наименование аппарата

Nocospray

Glosair 400

Наименование дез.средства

Nocolyse (картридж 1 л)

Glosair 400 (картридж 2 л)

Производитель

Oxy’pharm

ASP / Johnson and Johnson

Объем помещений, м3

От 10 до 1000

От 10 до 200

Габаритные размеры, мм

500х330х330

1080х512х620

Масса прибора

5.8 кг

55 кг

Потребляемая мощность

1000 Вт

1680Вт

Транспортировка

Корпус оснащен специальной ручкой для транспортировки

Корпус прибора оснащен колесами

Размер испускаемых частиц

1-5 мкм

8-12 мкм

II. Дезинфицирующее средство

Наименование дез.средства

Nocolyse

Glosair 400

Форма выпуска

Флакон 1л, канистра 5л

Картридж 2 л

Средняя производительность (номинальный расход)

1 л/час

1,8 л/час

Срок годности дез.средства в упаковке производителя

24 месяца

9 месяцев

Состав системы в стандартной комплектации

Аппарат + флакон

Аппарат + картридж + принтер + пульт

Итог: аппарат Nocospray способен дезинфицировать помещения большей площади; ощутимо меньше по габаритам и по весу — можно поднять и перенести, тогда как Глосейр можно только катить; потребляет меньше электричества. Размер испускаемых частиц мельче, чем у Глосейр. Времени для обработки помещения с помощью Нокоспрей требуется гораздо меньше, а доступ в обработанное помещение открывается раньше. Также преимуществом можно назвать более длительный срок годности дезсредства. А самое главное – Нокоспрей значительно дешевле, чем Глосейр.

Современное дезинфицирующие средства в медицине, дезсредства в медицине

Одной из важнейших проблем лечебных учреждений являются внутрибольничные инфекции. Заражение может произойти при лечебных и диагностических процедурах, а также естественным путем – контактно-бытовым или воздушно-капельным. Мы не беремся за оценку частоты и объемов заражения ВБИ, но можем подробно рассказать о тех дезинфицирующих веществах, которые используются в современной медицинской практике.

С целью предупреждения распространения внутрибольничных инфекций используются современные химические средства для дезинфекции больниц на основе хлора, перекиси водорода, спиртов, альдегидов и других дез веществ. Их активное использование для дезинфекции помещения, медицинских инструментов, оборудования сводит риск заражения практически к нулю. Однако, само понятие «дезинфекция» несколько шире, чем перечень дезинфицирующих средств и методы их применения. Существуют иные способы дезинфекции, кроме химической дезинфекции.

Способы дезинфекции

Дезинфекция – перечень химических, механических, физических манипуляций, специально предназначенных для уничтожения патогенных агентов, вызывающих различные болезни людей и животных.

Дезинфекция выполняется следующими методами:

  • кипячение;
  • ультрафиолетовое облучение;
  • озонирование воздуха;
  • паровая, воздушная стерилизация;
  • обработка химическими дезинфицирующими агентами.

По времени и месту проведения дезинфекция подразделяется на:

  1. Профилактическая дезинфекция — проводится если точный источник заражения невозможно выделить или его нет, для защиты от возможного заражения.
  2. Очаговая дезинфекция — производится при выявлении источника инфекции.

Очаговая дезинфекция включает в себя: текущую обработку, которая проводится в присутствии пациента и заключительную — осуществляется после ухода (выписки или смерти) больного для ликвидации очагов возбудителя.

Химическому обеззараживанию или иному методу дезинфекции подвергаются все медицинские инструменты, оборудование, поверхности и предметы, с которыми контактировал больной. Обязательна дезинфекция хирургических инструментов с последующей стерилизацией.

Дезинфицирующие средства

Используемые дезсредства в медицине классифицируются по своему составу, назначению. Они имеют разную степень антимикробной активности, токсичность, влияние на обрабатываемый ими объект. Официально разрешены к применению в лечебных учреждениях следующие современные дезинфицирующие средства:

  1. На основе хлора: Хлормисепт эконом. С помощью этих средств производится дезинфекция медицинских инструментов из пластмасс, резины, стекла. Хлорсодержащие препараты малотоксичны, однако вызывают коррозию металлов. Среди минусов можно отметить наличие запаха хлора.
  2. Растворы перекиси водорода: Альфадез окси. Обладают низкой токсичностью, не имеют запаха, используются для обеззараживания инструментов из резины, пластика, стекла. Не оказывает фиксирующее действие на органику.
  3. Альдегиды: Альфадез форте, Альфадез орто. Применяются для обеззараживания эндоскопов и сопутствующих инструментов, а также для уборки помещения и мытья оборудования. Обладают высокой активностью в отношении многих патогенных микробов. Альдегидные средства часто применяют для ДВУ и химической стерилизации, однако они обладают фиксирующим действием, поэтому требуют тщательной предварительной очистки и дезинфекции.
  4. Спиртосодержащие средства — антисетики: Миросептик, Экобриз антисептик, Эстилодез антисептик. Используются, как антисептик для обработки кожи перед инъекцией, для обеззараживания кожи, операционных полей.

Обязательной дезинфекции подлежат все предметы, контактирующие с кровью и соприкасающиеся с раневой поверхностью. Стерилизация медицинских инструментов осуществляется после их предварительной дезинфекции с использованием химических растворов или паровой стерилизации.

Дезинфекция рук

По данным ВОЗ около значительная часть инфекционных агентов передаются через руки. Мытье и гигиеническая антисептика кожи рук являются обязательным перед каждой медицинской манипуляцией и после нее. Это также справедливо для манипуляций в индустрии красоты (маникюр, педикюр, услуги подолога, опасное бритье в барбершопе и так далее).

Для уничтожения патогенной и условно-патогенной микрофлоры используются кожные антисептики:

  • бактерицидные гелиевые средства;
  • жидкое мыло антисептик с антибактериальным эффектом;
  • спиртовые антисептики;
  • бесспиртовые антисептики.

Средство для дезинфекции рук наносят на высушенную кожу и втирают до полного высыхания. Спиртовые растворы используются для обеззараживания кожи рук, преимущественно, перед хирургическими манипуляциями, время обработки составляет до 5 минут.

В качестве экстренной дезинфекции рук при осмотре больного можно использовать спиртосодержащие дезинфицирующие салфетки.

Выбирать дезсредство среди имеющегося многообразия следует в соответствии с целью их назначения. К сожалению, ни один современный препарат не обладает универсальными свойствами. Подход к дезинфекции в медицинских учреждениях должен быть комплексным, предполагающим использование нескольких групп препаратов, различного спектра действия.

Что важно знать при выборе дезинфицирующих средств? / Хабр

Прежде чем приобрести дезинфектант для обработки помещений, необходимо учесть ряд моментов, которые помогут лучше сориентироваться во всем многообразии средств и не совершить ошибку. В процессе отбора необходимо детально разобраться в особенностях дезсредства. Важно помнить: применение дезинфицирующего средства должно выполняться строго в соответствии с инструкцией производителя, заверенной профильным НИИ Роспотребнадзора. На практике это означает, что все рекомендованные в инструкции режимы применения соответствуют современным требованиям по эффективности и безопасности.

Почему при выборе дезинфицирующего средства нужно обращать внимание на то, против каких инфекций его можно успешно применять? Это позволит избежать ситуации, когда дезинфицирующее средство попросту не предназначено для тех целей, в которых планируется его использовать. Можно привести следующий пример. Для дезинфекции рук существует множество антисептиков, однако для борьбы с новым коронавирусом COVID-19 рекомендованы к применению только те, в чьем составе имеется не менее 60–80% изопропилового или этилового спирта. При меньшем содержании спирта уничтожение коронавируса не происходит.

Итак, про дезинфекцию помещений

Изначально важно ответить на вопрос, какая именно дезинфекция будет проводиться и где. В зависимости от режима применения выбирается группа химических действующих веществ.

Для дезинфекции в медицинских учреждениях, к примеру, в палатах где лежали больные с инфекциями (с туберкулезом и т.д.), будут актуальны более сильные и эффективные дезинфектанты. Для сфер, где не предполагается борьба с подобными «тяжелыми» инфекциями, могут использоваться иные средства.

Существует несколько основных групп химических действующих веществ. Наиболее распространенными из них являются катионные поверхностно-активные вещества (КПАВ) (четвертичные аммониевые соединения (ЧАС) и амины), хлорактивные и кислородактивные вещества, спирты и альдегиды.

КПАВ успешно применяются для обработки поверхностей, обладают хорошими моющими свойствами, однако они не эффективны против высокоустойчивых микроорганизмов (туберкулез, споровые формы).

Хлорактивные средства широко применяются для обработки в быту и не только. Стоит отметить, что при всей своей эффективности хлор обладает сильным коррозийным воздействием, продукты его взаимодействия токсичны (2 класс опасности (токсичности) по ГОСТ 12.1.007), а значит, необходимо соблюдать меры предосторожности.

Кислородактивные вещества (чаще всего используется перекись водорода и стабилизированный водный раствор диоксида хлора) успешно уничтожают высоко патогенные микроорганизмы, безопасны для человека и экосистемы, так как эффективны при низких концентрациях и небольшом расходе рабочих растворов.

Спирты с успехом применяются для дезинфекции небольших по объему поверхностей, на их основе выпускается много эффективных средств для рук. Однако спирты могут быть токсичны для человека, их пары – пожароопасны, именно по этой причине не рекомендуется обрабатывать более 10% поверхностей в помещениях спиртосодержащими средствами.

В процессе выбора дезинфицирующего средства важно прояснить, какие именно поверхности необходимо дезинфицировать. Это будут только контактные участки (ручки дверей, выключатели и тд.) или необходим более комплексный подход?

К примеру в соответствии с рекомендациями Роспотребнадзора для организаций общественного питания обработка контактных поверхностей должна выполнятся каждые 2-4 часа. Должны дезинфицироваться дверные ручки, выключатели, поручни и проч. Контактные поверхности чаще обрабатывают вручную тряпками или спреями, часто – в присутствии людей.

В данном ключе крайне важно обратить внимание на класс токсичности дезсредства, о котором мы уже писали выше. Напомним, что различают четыре класса токсичности, 4-й – наиболее безопасный. Дезинфектанты, относящиеся к данному классу, могут применяться без средств защиты (СИЗ) и в присутствии людей. Дезсредства 3-го класса не применяются в присутствии пациентов в медицинских учреждениях, являются умеренно опасными. 2 класс токсичности обязывает применять средства защиты органов дыхания и глаз, а дезинфекция выполняется при отсутствии посторонних людей. 1 класс – наиболее токсичный. Его мы рассматривать в данном материале не будем.

При ручной обработке поверхностей могут использоваться водные растворы кислородактивных дезинфектантов (перекись водорода h3O2, диоксид хлора ClO2, отдельные из них относятся к 4 классу токсичности), хлорактивные (гипохлорита натрия – NaClO), катионные поверхностно-активные вещества, альдегиды. В отдельных случаях применяются четвертичные аммониевые соединения (ЧАС). Относительно широкая распространенность средств на основе ЧАС на рынке связана с их достаточно низкой токсичностью и отсутствием выраженного коррозионного воздействия, однако, как уже упоминалось, ЧАС-ы зачастую малоэффективны.

Средства на основе активного кислорода производятся в виде жидких концентратов. Данные соединения отличаются высокой антимикробной активностью и применяются для борьбы в том числе с новой коронавирусной инфекцией COVID-19.

Традиционные хлорактивные вещества также популярны, однако, к примеру, у гипохлорита натрия (NaClO) есть особенности, делающие его не самым лучшим решением в сравнении с другими средствами. Так, необходимое количество для обработки 1 кв.м помещения или другого объекта у NaClO составляет порядка 100-300 мл., против 6-30 мл./м3 для аналогичного объема у перекиси водорода (h3O2), и 10 мл. – у диоксида хлора (ClO2). Гипохлорит натрия (NaClO) также вызывает коррозию.

Подробнее об особенностях основных групп дезинфицирующих средств читайте в нашем отдельном обзоре здесь.

В случае проведения комплексной дезинфекции выполняется обработка не только поручней и дверных ручек, но также воздуха и всех поверхностей, в том числе труднодоступных. Подобная обработка служебных помещений, мест общественного пользования может выполняться ежедневно (ежесменно / ежемесячно) по завершению рабочего дня или во время генеральной уборки.

Фрагмент документа: РЕКОМЕНДАЦИИ ПО ОРГАНИЗАЦИИ РАБОТЫ ПРЕДПРИЯТИЙ ОБЩЕСТВЕННОГО ПИТАНИЯ В УСЛОВИЯХ СОХРАНЕНИЯ РИСКОВ РАСПРОСТРАНЕНИЯ COVID-19:

В этих целях могут применяться как ручная дезинфекция швабрами и тряпками, так и орошение спреями и более современное аэрозольное распыление. И если протирание контактных поверхностей тряпками в течение дня зачастую обусловлено необходимостью делать это в присутствии людей, то подобный метод по окончании дневной смены уже не имеет такого смысла.


Halosil

Помещения могут более эффективно обрабатываться аэрозолем, который характеризуется хорошим покрытием труднодоступных мест и не только (контактные поверхности, щели, углы, потолок, вентиляция и проч.). Обработку аэрозолем выполняют в отсутствии людей, она может проводиться либо вечером/ночью, либо в специальные перерывы днем (с последующим проветриванием). Данный метод может применяться как для регулярной профилактической дезинфекции, так и при очаговой дезинфекции, к примеру, в качестве заключительной обработки помещений. В последнее время метод получил широкое распространение в мире. Для аэрозольного распыления чаще всего применяют кислородактивные дезинфицирующие средства, о которых мы писали выше (перекись водорода – h3O2, диоксид хлора – ClO2).


Help stop the spread of COVID-19 with mobile dry fog disinfection unit

На что еще важно обратить внимание при выборе дезсредства?


На Свидетельство о государственной регистрации, ОНО ДОЛЖНО БЫТЬ!

Основным документом, подтверждающим безопасность дезинфицирующего средства является именно Свидетельство о государственной регистрации. Проверить наличие государственной регистрации дезинфицирующего средства можно также в Реестре свидетельств о государственной регистрации

по ссылке

. В случае отсутствия в Реестре обозначенного дезинфицирующего средства, его оборот

является незаконным

.

Каждое дезинфицирующее средство должно также иметь инструкцию по применению, которую продавец по первому требованию обязан предоставить покупателю вместе с копией Свидетельства о государственной регистрации средства. Применение любого дезинфицирующего средства должно выполнятся строго в соответствии с инструкцией профильного НИИ.

Индикаторные полоски «Дихлорантин» | ООО «Дельта хим-тэк»

Информация о товаре

Инструкция по применению полосок индикаторных для экспресс-контроля концентраций рабочих растворов дезинфицирующих средств на основе дихлорантина

1. Назначение

Полоски индикаторные химические, выпускаемые в соответствии с ТУ 2642-014-66948373-2010, являются изделиями однократного применения и предназначены для визуального контроля концентраций рабочих растворов дезинфицирующих средств на основе дихлорантина: Сульфохлорантин Д, ДезХлорантин и др. с концентрациями 0,015; 0,03; 0,045; 0,075; 0,15; 0,2; 0,3; 0,375; 0,5; 1,0; 1,5; 2,0 % по активному хлору.

В комплект поставки входят: индикаторные полоски; элемент сравнения; инструкция по применению; контрольные наклейки; упаковочный пакет.

Индикаторные полоски предназначены для персонала лечебно-профилактических учреждений, работников дезинфекционной и санитарно-эпидемиологическй служб, а также других учреждений, имеющих право заниматься дезинфекционной деятельностью.

2. Применение

В мензурку или стакан наливают 50-100 мл хорошо перемешанного рабочего раствора дезинфицирующего средства комнатной температуры. Из упаковки достают индикаторную полоску и погружают её на 1-2 секунды в раствор так, чтобы были смочены все индикаторные зоны. Полоску извлекают из раствора и быстро удаляют избыток жидкости, проводя ребром полоски о край стакана. Полоску кладут на белую фильтровальную бумагу или бумажную салфетку индикаторной зоной вверх и выдерживают 15 секунд (по секундомеру или часам с секундной стрелкой). После чего в течение не более 10 секунд сопоставляют цвет индикаторной зоны с цветовой шкалой элемента сравнения, определяя концентрацию рабочего раствора.

Таблица разведения растворов, концентрации которых не приведены на цветовой шкале

Концентрация исходного раствора  по активному хлору, % Разведение, мл Концентрация, определяемая по шкале, %
Исходный раствор Вода
0,045 30 60 0,015
0,2 75 25 0,15
0,3 50 50 0,15
0,375 40 60 0,15
0,5 30 70 0,15
1,0 15 85 0,15
1,5 10 90 0,15
2,0 6 74 0,15

Примечания:

1. Необходимо соблюдать указанное время выдержки индикаторных полосок в анализируемой воде и на фильтровальной бумаге. 2. Сопоставление цвета индикаторной полоски с цветовой шкалой элемента сравнения следует проводить в условиях нормальной освещенности рабочего места. Появление на индикаторных полосках ореолов, не изображенных на элементе сравнения, считать несущественным. 3. Определение концентрации рабочего раствора проводят три раза. Результат определения считается достоверным, если он оказался одинаковым не менее чем в двух повторных определениях. При необходимости повторения анализа, используют свежую порцию раствора.

Внимание:

– При первоначальном вскрытии упаковки с тест-полосками, указывайте дату вскрытия на этикетке; – Пары химических веществ могут оказать влияние на результаты определения, поэтому при хранении и применении индикаторных полосок избегайте паров химических веществ; – Извлекайте из пенала только необходимое для определения количество индикаторных полосок, пенал не держите открытым; – Не удаляйте избыток раствора с полосок фильтровальной бумагой; – Используйте прилагаемый элемент сравнения только для данной упаковки индикаторных полосок; – Не подвергайте элемент сравнения воздействию прямого солнечного света и дезинфицирующих средств; – Не применяйте для дезинфекции порции раствора, использованные для определения концентрации.

3. Заполнение отчетной документации

После трехкратного определения концентрации рабочего раствора дезинфицирующего средства и получения достоверного результата, в журнал контроля концентраций рабочих растворов дезинфицирующих и стерилизующих средств вносится запись в соответствии с правилами заполнения данного журнала. В графу журнала «Метод анализа» вклеивается контрольная наклейка из комплекта, свидетельствующая о проведении анализа с помощью индикаторных полосок.

4. Требования безопасности

Индикаторные полоски не выделяют в окружающую среду токсичных веществ, и не оказывают вредного влияния на организм человека при непосредственном контакте. При работе с индикаторными полосками специальных мер безопасности и защиты окружающей среды не требуется. После использования индикаторные полоски подлежат утилизации как бытовые отходы.

5. Хранение и транспортирование

Индикаторы хранят и транспортируют в упаковке изготовителя при температуре от минус 15°С до плюс 30°С и влажности не более 80%, не подвергая воздействию паров химических веществ. Срок годности в невскрытой упаковке изготовителя – 18 месяцев. Гарантийный срок годности индикаторных полосок после первоначального вскрытия упаковки – 3 месяца.


Внимание: не используйте распечатанную цветовую шкалу для определения концентрации активного хлора в рабочих растворах дезинфицирующих средств на основе дихлорантина. Сопоставление окрашивания индикаторной полоски следует проводить только с тем эталоном, который прилагается к упаковке с тест-полосками.

Дезинфицирующие средства: антисептики, салфетки, жидкое мыло

На странице: 15255075100

Сортировка: По умолчаниюНаименование (А -> Я)Наименование (Я -> А)Цена (по возрастанию)Цена (по убыванию)Рейтинг (по убыванию)Рейтинг (по возрастанию)Модель (А -> Я)Модель (Я -> А)

Краткая информация В качестве действующих веществ содержит пропанол-1 (н-пропанол) 25%, пропанол-2 (..

Назначение: -для дезинфекции и мытья поверхностей в помещениях, жесткой и мягкой мебели, напольных ..

Краткая информация актибор содержит N,N-бис(3-аминопропил) додециламин в щелочной среде суммарно со ..

Краткая информация биодез экстра содержит 50% дидецилдиметиламмоний бромида в качестве действующего ..

Препарат традиционен по составу действующих веществ (ДВ). Однако рецептура его уникальна, так среди ..

Назначение: обеззараживания и дезодорации содержимого накопительных баков (баков-сборников) туалетны..

Форма выпуска: полиэтиленовые флаконы объемом 0,5-1,0 дм3, полиэтиленовые канистры 2-20 дм3, полиэти..

Назначение: дезинфекции изделий медицинского назначения из различных материалов, поверхностей в поме..

Назначение: для дезинфекции, в том числе совмещенной с предстерилизационной очисткой ручным способом..

Назначение: дезинфекции поверхностей в помещениях, санитарно-технического оборудования, предметов об..

Краткая информация мистраль содержит N,N-бис-(3-аминопропил) додециламин (амин) – 7,5%, а также вспо..

Специально для рук медицинского персонала было разработано жидкое мыло «СКИНИЯ» с антибактериальным ..

Краткая информация жидкое мыло Ухажер содержит воду питьевую очищенную, натрия лаурет сульфат, кокам..

Антисептик представляет собой прозрачную бесцветную жидкость с легким запахом применяемой отдушки. А..

Кожный антисептик для обработки рук оперирующего персонала и пациентов, для обработки кожи операцион..

Для обработки рук и перчаток, а также операционного и инъекционного поля ООО «БМТ-Медтехника» представляет широкий выбор антисептиков и дезинфицирующих средств. В их числе средства для дезинфекции рабочих поверхностей, медицинских изделий и аппаратуры, мебели, санитарно-технического оборудования. Это жидкости (Деконекс 50ФФ, Дез-хлор, Биодез-Экстра и др.), активное вещество которых, обладает бактерицидным (в т.ч. на возбудителя туберкулеза), фунгицидным, противовирусным действием и моющими свойствами.

Кожные антисептики на основе изопропилового спирта (Dezodent HW, Лизанол, Скиния)  обладают широким спектром антимикробного влияния и пролонгированным действием. Специальные добавки позволяют смягчить воздействие на кожу.

Салфетки для дезинфекции Dezodent WIPE (Германия) предназначены для обработки всех типов поверхностей в медицинских учреждениях разного профиля. Они обладают высокой антимикробной активностью, включая воздействие на бактерии, вирусы, грибки. При этом не вызывают сенсибилизацию и интоксикацию пациентов и медперсонала.

Столовые и кухонные приборы | kaup24.ee

Кухонные инструменты 

Все любители готовить согласятся с тем, что надлежащим образом подобранные кухонные инструменты создают комфортную атмосферу и позволяют без труда готовить даже самые сложные блюда. Ножи, ложки, вилки, ложечки – все эти кухонные приборы хорошо знакомы каждому. Однако в настоящее время в продаже можно найти гораздо больше вариантов, гарантирующих максимальный уровень комфорта на кухне.

Для достижения гармонии, в стремлении к созданию единого стиля многие выбирают наборы, комплекты кухонных приборов. Такое решение позволяет позаботиться сразу обо всех необходимых приборах, которые с точки зрения стиля будут сочетаться между собой. В таком случае может пригодиться набор кухонных приборов со стойкой – ее красивый дизайн может стать акцентом кухонного интерьера, а Вы всегда будете иметь все необходимые приборы под рукой.

Тем, кто стремится к созданию максимального удобства в этом помещении, понравится сушилка для кухонных инструментов, а удобно сложить все необходимое позволят специальные держатели для кухонных инструментов. Их можно выбирать по материалу, из которого они изготовлены. Особо большой популярностью пользуются деревянные кухонные инструменты, которые радуют своей прочностью. Однако им также не уступают силиконовые кухонные инструменты, которые высоко ценятся за их эластичность и простой уход.

Вас интересуют кухонные инструменты для профессионалов, стойка, чехол, для кухонных инструментов, или другие кухонные инструменты и аксессуары? Ознакомьтесь с ассортиментом предлагаемых нами товаров. В электронном магазине kaup24.ee профессиональные кухонные инструменты, чехлы и другие товары, предназначенные для работ на кухне, продаются по очень низким ценам. А часто проводимые акции дают возможность позаботиться о приобретении этих товаров по гораздо меньшим ценам.

Также удобно и то, что если Вам нужен новый комплект кухонных инструментов, держатель, вешалка или другие изделия, Вам больше не нужно искать, где находится ближайший магазин кухонных инструментов, так как все эти товары можно приобрести не выходя из дома. Кухонные инструменты можно заказать через интернет всего несколькими нажатиями на кнопку. Выберите, какие изделия Вам необходимы, и мы позаботимся о том, чтобы они в ближайшее время были доставлены к Вам на дом.

В ассортименте нашего электронного магазина Вы найдете кухонные инструменты Fiskars и предлагаемые другими производителями товары, начиная с простых лопаток и заканчивая большими наборами кухонных инструментов, которые своей функциональностью понравятся не только профессионалам, но и новичкам в приготовлении пищи.

Столовые и кухонные приборы | kaup24.ee

Кухонные инструменты 

Все любители готовить согласятся с тем, что надлежащим образом подобранные кухонные инструменты создают комфортную атмосферу и позволяют без труда готовить даже самые сложные блюда. Ножи, ложки, вилки, ложечки – все эти кухонные приборы хорошо знакомы каждому. Однако в настоящее время в продаже можно найти гораздо больше вариантов, гарантирующих максимальный уровень комфорта на кухне.

Для достижения гармонии, в стремлении к созданию единого стиля многие выбирают наборы, комплекты кухонных приборов. Такое решение позволяет позаботиться сразу обо всех необходимых приборах, которые с точки зрения стиля будут сочетаться между собой. В таком случае может пригодиться набор кухонных приборов со стойкой – ее красивый дизайн может стать акцентом кухонного интерьера, а Вы всегда будете иметь все необходимые приборы под рукой.

Тем, кто стремится к созданию максимального удобства в этом помещении, понравится сушилка для кухонных инструментов, а удобно сложить все необходимое позволят специальные держатели для кухонных инструментов. Их можно выбирать по материалу, из которого они изготовлены. Особо большой популярностью пользуются деревянные кухонные инструменты, которые радуют своей прочностью. Однако им также не уступают силиконовые кухонные инструменты, которые высоко ценятся за их эластичность и простой уход.

Вас интересуют кухонные инструменты для профессионалов, стойка, чехол, для кухонных инструментов, или другие кухонные инструменты и аксессуары? Ознакомьтесь с ассортиментом предлагаемых нами товаров. В электронном магазине kaup24.ee профессиональные кухонные инструменты, чехлы и другие товары, предназначенные для работ на кухне, продаются по очень низким ценам. А часто проводимые акции дают возможность позаботиться о приобретении этих товаров по гораздо меньшим ценам.

Также удобно и то, что если Вам нужен новый комплект кухонных инструментов, держатель, вешалка или другие изделия, Вам больше не нужно искать, где находится ближайший магазин кухонных инструментов, так как все эти товары можно приобрести не выходя из дома. Кухонные инструменты можно заказать через интернет всего несколькими нажатиями на кнопку. Выберите, какие изделия Вам необходимы, и мы позаботимся о том, чтобы они в ближайшее время были доставлены к Вам на дом.

В ассортименте нашего электронного магазина Вы найдете кухонные инструменты Fiskars и предлагаемые другими производителями товары, начиная с простых лопаток и заканчивая большими наборами кухонных инструментов, которые своей функциональностью понравятся не только профессионалам, но и новичкам в приготовлении пищи.

границ | Влияние различных дезинфицирующих средств на разнообразие бактериального аэрозоля в птичниках

Введение

В последние годы, с непрерывным улучшением интенсификации животноводства и аквакультуры, увеличилась плотность содержания животных. Кроме того, ускоряется распространение инфекционных болезней животных, возникают различные эпидемии среди животных (Wu et al., 2012; Mellata, 2013; Mughini-Gras et al., 2014; Threlfall et al., 2014; Barbosa et al., 2017; Поулсен и др., 2017; Стромберг и др., 2017; Винаянанда и др., 2017). Таким образом, дезинфекция животноводческих и птицеводческих помещений стала важной мерой профилактики и борьбы с болезнями. Обычно используемые химические дезинфицирующие средства для бройлерных птичников включают доступный хлор, озон, четвертичную аммониевую соль и глутаровый альдегид (Meroz and Samberg, 1995; Saklou et al., 2016; Chidambaranathan and Balasubramanium, 2017). Различные дезинфицирующие средства, используемые для крупномасштабной дезинфекции бройлерных птичников, действуют по разным механизмам, поэтому эффективность их дезинфекции также различается (Suwa et al., 2013; Чидамбаранатан и Баласубраманиум, 2017 г.; Мартенс и др., 2017). В настоящее время хлорсодержащие соединения (дихлоризоцианурат натрия, гипохлорит натрия, хлорная известь, диоксид хлора и др.) широко используются в качестве дезинфицирующих средств в животноводстве и птицеводстве (Van Klingeren, 1995; Boxall et al., 2003). Доступный хлор может эффективно уничтожать Mycobacterium tuberculosis , Enterobacter , Enterococcus , Staphylococcus aureus и Bacillus subtilis var.niger в низкой концентрации (Boxall et al., 2003; Hakuno et al., 2010; Suwa et al., 2013). Многие исследования показали, что хлорсодержащие соединения могут убивать микроорганизмы, изменяя структуру их клеточных мембран (Venkobachar et al., 1977; Virto et al., 2005; Liu et al., 2006; Berg et al., 2010). Озон представляет собой трехатомную газообразную молекулу, которая действует как мощный окислитель и используется в медицине более 150 лет (Elvis and Ekta, 2011). Озон имеет широкое медицинское применение благодаря своей эффективной противомикробной функции (Ozturk et al., 2017) и антиоксидантной защиты (Delgadoroche et al., 2017). Грамотрицательные бактерии более чувствительны к озону, чем грамположительные бактерии, а бактерии более чувствительны, чем тестируемый штамм дрожжей (Moore et al., 2000). Якобс и Гейдельбергер (1915) впервые синтезировали соединение соли четвертичного аммония, обладающее бактерицидной способностью. Бактерицидный механизм солей четвертичного аммония включает изменение проницаемости клеток, что приводит к экстравазации бактериального содержимого. Четвертичная аммониевая соль является катионным поверхностно-активным веществом.Учитывая, что катионы проявляют бактерицидное действие, основанное на липофильности, и что клеточная стенка грамположительных бактерий содержит больше липидов, чем у грамотрицательных бактерий, грамположительные бактерии легче инактивируются четвертичным аммонием. Глутаровый альдегид может действовать непосредственно на бактериальные белки и ферменты и, таким образом, влиять на метаболизм бактерий и вызывать их гибель. Глутаровый альдегид также может предотвратить высвобождение дигидрохлорида из внешнего слоя бактериальных спор, чтобы предотвратить спорообразование.Поэтому глутаровый альдегид чаще применяется для дезинфекции в бройлерных птичниках (Battersby et al., 2017; Castro et al., 2017). Глутаровый альдегид обладает широким спектром бактерицидного действия с высокой эффективностью уничтожения бактерий и вирусов. Глутаровый альдегид также оказывает сильное воздействие на споры, продуцируемые Clostridium , которые могут вызывать некротический энтерит, и поэтому обычно используется для дезинфекции бактериальных спор во время эпидемий (Miner et al., 1993; Rutala et al., 1993; Брантнер и др., 2014).

Во время интенсивного земледелия домашний скот и птица могут выделять бактерии и вирусы, в том числе условно-патогенные микроорганизмы, с фекалиями и дыхательными путями и генерировать в воздухе биоаэрозоли, которые могут нанести вред человеку и окружающей среде (Hojovec, Fiser, 1968; Бессарабов и др. , 1972; Петков, Цуцумански, 1975; Петков, Байков, 1984; Петков и др., 1987; Just и др., 2011а,б). После переноса или уничтожения цыплят пустой бройлерный птичник остается загрязненным в разной степени.Дезинфекция пустующих птичников — важный шаг в борьбе с болезнями на крупных птицефермах. Дезинфекция может уменьшить или убить потенциально патогенные микроорганизмы в птичнике и предотвратить передачу патогенных микроорганизмов между партиями. Различные процедуры дезинфекции дают разные результаты, поэтому выбор соответствующих дезинфицирующих средств, а также процедур и методов дезинфекции может эффективно контролировать возникновение инфекционных заболеваний в птичниках. Эти методы в основном включают очистку, замачивание, фумигацию, распыление и УФ-облучение.Аэрозольные дезинфицирующие средства применяются уже более полувека. Аэрозоль может сохранять материалы и образовывать дезинфицирующую систему аэрозоль-дезинфицирующее средство в виде пара (Wichelhaus et al., 2006; Carvalho et al., 2015; Saklou et al., 2016). С применением технологии ультразвукового распыления жидкости можно распылять до аэрозольного состояния с получением равномерно диспергированных капель размером 2–4 мкм. Распыленные капли играют роль «затравочных частиц» и образуют ядро ​​агрегации в аэрозоле, которое может эффективно сталкиваться с окружающими мелкими частицами для повышения эффективности агрегации.После распыления дезинфицирующего средства в воздух выделяется большое количество водяного пара, что увеличивает относительную влажность в помещении, улучшает проникающую способность дезинфицирующего средства на бактериальную стенку, усиливает эффект дезинфекции и сокращает время дезинфекции (Muñoz et al. ., 2017).

Идеальное дезинфицирующее средство должно обладать хорошей способностью убивать патогенные микроорганизмы; быть стабильным по своей природе, чтобы на него не оказывали легкого воздействия физические и химические факторы, такие как качество воды и органические вещества; и эффективно контролировать экологическую санитарию птицефермы.Поэтому тестирование на наличие микроорганизмов, оставшихся после дезинфекции пустующих домов, является важным средством оценки эффективности дезинфекции. Для обнаружения микробных аэрозолей можно использовать многочисленные методы, такие как подсчет микробных культур, прямое микроскопическое обнаружение, технология биосенсоров и технология генных чипов. Эти методы являются традиционными и не могут точно обнаруживать микроорганизмы, которые трудно культивировать или которые присутствуют в воздухе в малых количествах. Методы высокопроизводительного секвенирования ДНК можно использовать для характеристики микробных систем с помощью анализа последовательности 16S рРНК.(Корайкич и др., 2015; Цзя и др., 2016). Преимуществом данной технологии является ее способность выявлять микроорганизмы, которые трудно получить методами культивирования; поэтому эта технология широко используется во многих областях (O’Brien et al., 2014; Tian et al., 2017). Технология высокопроизводительного секвенирования может быть использована для оценки влияния дезинфекции на распространение микроорганизмов и структуру микробных сообществ в пустующих домах. В этом исследовании для дезинфекции птичников использовали пять широко используемых дезинфицирующих средств.Состав микробиоты после лечения анализировали с помощью высокопроизводительного секвенирования 16s рРНК и сравнивали с микробиотой в необработанном доме. Исследовано влияние различных дезинфицирующих средств на количество и разнообразие микроорганизмов в пустых бройлерных птичниках. Это исследование дает рекомендации по правильному применению дезинфицирующих средств для профилактики заболеваний и разработки процедур дезинфекции.

Материалы и методы

Коллекция образцов

Эксперименты проводились в Яньтае, провинция Шаньдун, Китай, зимой 2016 года.В радиусе 10 км от нашей экспериментальной фермы жителей и других хозяйств не было. Бройлеры выращивались на сетке, а птичники имели длину 100 м, ширину 14 м и высоту 3,2 м. Вместимость каждого бройлерного птичника составляла примерно 20 000 голов. Температура внутри дома была 28°С, влажность 65–70%. Птичники были полностью оборудованы вентиляторами и влажными завесами, продольной механической вентиляцией, автоматическими линиями подачи и подачи воды. Бройлеры имели свободный доступ к корму и воде.В этом исследовании использовалась система дезинфекции ультразвуковым распылением (Shunxiang Farming Equipment Co., Ltd., Китай), а дезинфицирующий спрей был приготовлен до определенной концентрации с использованием воды из глубокой скважины. Количество дезинфицирующего спрея рассчитывали исходя из 15 мл/м 3 птичника. Для эксперимента были отобраны пять бройлерных птичников, которые обрабатывались пятью видами дезинфицирующих средств: озоном (100 г/ч, 1 ч), доступным хлором (1:1500, спрей), четвертичной аммониевой солью (1:2000, спрей), глутаровый альдегид (1:1000, спрей) и смешанное дезинфицирующее средство (включая альдегиды, четвертичную аммониевую соль и спирт, 1:1500, спрей).Бактериальные аэрозоли в бройлерных птичниках собирали. Образцы, собранные после очистки бройлерных птичников и промывки куриного помета, использовались для данных образцов необработанных птичников, тогда как образцы, собранные через 72 часа после дезинфекции бройлерных птичников, использовались в качестве данных обработанных образцов.

Обнаружение и анализ переносимых по воздуху культивируемых бактерий

Девять точек отбора проб были установлены в птичнике с тремя колоннами для отбора проб вдоль продольного направления птичника.Две колонки для отбора проб слева и справа находились на расстоянии 1 м от двух продольных стен птичника и в 6 м от средней колонки для отбора проб. Три точки отбора проб были равномерно распределены в каждой пробной колонке на расстоянии 32 м друг от друга (рис. 1). Все высоты отбора проб составляли 0,5 м. Отбор проб проводили с помощью воздушного микробного коллектора Andersen-6 (SKC, Филадельфия, Пенсильвания, США) (Andersen, 1958). Для того чтобы точно оценить ущерб от бактериального аэрозоля на приближающихся цыплят в ближайшее время в обработанном помещении, использовали пробоотборник «Андерсен-6».Пробоотборник имитировал анатомо-аэродинамические характеристики дыхательных путей животных и был спроектирован по принципу инерционного удара. По принципу пробоотборника можно оценить, насколько велика частица бактерий, которую вдохнула курица, и в какой части тела произошло осаждение. Пробоотборник был разделен на шесть ступеней по 400 отверстий на ступень. Диаметр отверстий постепенно уменьшался сверху вниз следующим образом: этап 1, >7.1 мкм; стадия 2 — от 4,7 до 7,1 мкм; стадия 3 — от 3,3 до 4,7 мкм; стадия 4 — от 2,1 до 3,3 мкм; стадия 5 — от 1,1 до 2,1 мкм; и стадия 6, от 0,65 до 1,1 мкм. При скорости потока воздуха 28,3 л⋅мин -1 скорость потока увеличивалась поэтапно, так что частицы в воздухе собирались в чашках Петри для пробоотборника на разных стадиях в зависимости от размера частиц. Поток воздуха через пробоотборник Андерсена контролировали с помощью массового расходомера (TopTrak 826; Sierra Instruments, Монтерей, Калифорния, США). Пробы воздуха были собраны в необработанных бройлерных птичниках и птичниках, обработанных пятью типами дезинфицирующих средств, при следующих условиях: время отбора проб 2 минуты, среда для отбора проб 5% дефибринированной овечьей крови и соевого агара (приобретена у Qingdao Hope Bio-technology Co., Ltd., Китай), 37°С и 24 ч. Количество переносимых по воздуху колоний рассчитывали по следующей формуле:

РИСУНОК 1. Расположение мест отбора проб в тестируемом бройлерном помещении.

С=(Н×1000)/(т×Ф),

, где C представляет собой концентрацию бактериального аэрозоля в КОЕ⋅м -3 ; N – количество колоний на каждой стадии; t – время выборки в мин; F – расход воздуха для отбора проб в л⋅мин −1 .

Отбор проб и анализ общего бактериального аэрозоля в воздухе

Суммарный бактериальный аэрозоль в воздухе собирали с помощью биосамплера (SKC, США). Места отбора проб находились на высоте 0,5 м над землей, и 50 мл раствора для отбора проб (фосфатный буферный раствор, PBS) помещали в бутылку для отбора проб. Расход воздуха составлял 12,8 л⋅мин -1 , время отбора проб 90 мин. Ультрацентрифугирование проводили при 70000 об/мин⋅мин -1 в течение 2 часов. Суммарную бактериальную РНК экстрагировали с использованием набора EasyPure Viral DNA/RNA Kit (Beijing TransGen Biotech Co.ООО, Китай). Для синтеза кДНК методом обратной транскрипции использовали набор для обратной транскрипции EasyScript One-Step gRNA Removal and cDNA Synthesis SuperMix (Beijing TransGen Biotech Co., Ltd., Китай), полученные образцы хранили при -20°C. ПЦР-амплификацию проводили с набором праймеров 515F/907R (515F: GTGCCAGCMGCCGCGGTAA, 907R: CCGTCAATTCCTTTGAGTTT), нацеленным на гипервариабельную область V4-V5 бактериального гена 16S рРНК (Chen et al., 2016, 2017; Guo et al., 2018). Реакции ПЦР проводили в объеме 30 мкл, содержащем 12 мкл стерильной воды, 1.0 мкл шаблона ДНК, 1,0 мкл каждого праймера и 15 мкл 2 × Phusion ® High-Fidelity PCR Master Mix с буфером GC (New England Biolabs, Ипсвич, Массачусетс, США). Протокол ПЦР проводили при следующих условиях: начальная денатурация при 95°С в течение 3 мин; 30 циклов денатурации при 94°С в течение 30 с, отжига праймеров при 50°С в течение 1 мин и удлинения при 72°С в течение 1 мин; и конечное удлинение 10 мин при 72°С. Повторные ампликоны объединяли для очистки с помощью набора для экстракции из геля Qiagen (Qiagen, Германия).Наконец, в Novogene (Пекин, Китай) с использованием платформы Illumina HiSeq 2500 было проведено секвенирование и конструирование библиотек клонов гена 16S рРНК, и были созданы считывания парных концов длиной 250 п.н. Было взято три биологических повтора соответственно на трех участках отбора проб в каждом бройлерном помещении (как необработанных, так и обработанных дезинфицирующим средством).

Обработка и анализ последовательности

считывания с парными концами были вырезаны из штрих-кода и букваря с использованием самописных сценариев Python и собраны с помощью FLASH (Magoč and Salzberg, 2011).Качественная фильтрация данных выполнялась с использованием программного конвейера Quantitative Insights Into Microbial Ecology (QIIME) (Caporaso et al., 2010). Объединенные последовательности низкого качества (среднее значение качества <20) были удалены из последующего анализа. Химерные последовательности удаляли с помощью UCHIME (Edgar et al., 2011). Поэтому чтения, которые являются одиночными после фильтрации качества и глобальной обрезки, отбрасываются, а чтения с количеством двух или более используются в качестве входных данных для кластеризации OTU. Операционные таксономические единицы (OTU) были определены с 97% сходством с помощью программного обеспечения UPARSE (Edgar, 2013).Для аннотирования гена 16S рРНК использовалась база данных GreenGene на основе алгоритма классификатора RDP для аннотирования таксономической информации. Относительную численность (%) отдельных таксонов в каждом сообществе оценивали путем сравнения количества последовательностей, отнесенных к конкретному таксону, с общим количеством последовательностей, полученных для этой выборки. Альфа-разнообразие применялось для анализа сложности видового разнообразия для выборки с помощью шести индексов, включая наблюдаемые виды, Chao1, Shannon, Simpson, ACE, Goodcoverage.Все эти индексы в наших выборках были рассчитаны с помощью QIIME 1.7.0 (Kuczynski et al., 2011). Все необработанные последовательности депонированы в GenBank под регистрационным номером PRJNA464160.

Статистический анализ

Статистическую обработку и построение экспериментальных данных проводили в программах Excel (Microsoft, США), SPSS 22.0 (IBM, США) и GraphPad Prism 5 (GraphPad Software, США). Значимость экспериментальных данных была обработана с использованием однофакторного дисперсионного анализа (Majtán and Majtánova, 1999).Разница с P < 0,05 считалась значимой, а разница с P < 0,01 считалась чрезвычайно значимой.

Результаты и анализ

Содержание и гранулометрический состав аэробных бактерий в бройлерных птичниках, обработанных и необработанных дезинфицирующим средством

Концентрации аэрозолей в необработанных и обработанных дезинфицирующими средствами бройлерных птичниках представлены на рис. 2. В обработанных птичниках бактериальная нагрузка была ниже, чем в необработанных птичниках.После обработки различными дезинфицирующими средствами самые высокие и самые низкие концентрации бактериальных аэрозолей были обнаружены в бройлерном помещении, обработанном доступным хлором и смешанным дезинфицирующим средством при 7,67 × 10 2 КОЕ/м 3 и 0,22 × 10 2 КОЕ/м 3 соответственно. Очевидно, эффективность смешанного дезинфицирующего средства в отношении культивируемых бактерий была выше, чем у четырех других дезинфицирующих средств ( P < 0,05).

РИСУНОК 2. Общее количество бактерий в необработанном и обработанном дезинфицирующими средствами воздухе ( n = 9). A: Без дезинфекции; Б: озон; C: доступный хлор; D: четвертичная аммониевая соль; Е: глутаровый альдегид; F: смешанное дезинфицирующее средство.

Как показано в Таблице 1, распределение размеров частиц переносимых по воздуху аэробных бактерий в бройлерных птичниках, обработанных дезинфицирующими средствами, значительно изменилось по сравнению с необработанными птичниками. Распространение аэробных аэробных бактерий в бройлерных птичниках, обработанных различными дезинфицирующими средствами, уменьшилось по сравнению с III–VI стадиями коллекторов Андерсена-6.По сравнению с пустым птичником, не обработанным дезинфицирующими средствами, распределения на стадиях III–VI для бройлерных птичников, продезинфицированных доступным хлором, четвертичной аммониевой солью, глутаровым альдегидом и смешанным дезинфицирующим средством, были значительно снижены. В бройлерном помещении, обработанном смешанным дезинфицирующим средством, доля переносимых по воздуху аэробных бактерий V–VI стадий достоверно снизилась с 35,1 до 0% по сравнению с долей до дезинфекции, а глутаровый альдегид уменьшился с 35.от 1 до 1,6%.

ТАБЛИЦА 1. Иерархическое распределение необработанных и обработанных дезинфицирующими средствами бактерий.

Анализ последовательности с помощью высокопроизводительного секвенирования

После секвенирования области V4–V5 (515F-907R) бактериального гена 16S рРНК у переносимых по воздуху бактерий общее количество необработанных последовательностей в образцах составило 531 093. После фильтрации низкокачественных последовательностей общее количество эффективных последовательностей составило 508 143. После того, как последовательности подверглись контролю качества, последовательности были сгруппированы в OTU для таксономической классификации при 97% идентичности.Все образцы дали в общей сложности 1995 OTU (дополнительная таблица S1) со средней длиной 372 п.н. Информация о последовательности для каждого образца представлена ​​в таблице 2.

ТАБЛИЦА 2. Информация о последовательности образцов.

Анализ структуры микробного сообщества

На уровне микробной таксономии (рис. 3А) переносимые по воздуху микроорганизмы, собранные в бройлерных птичниках, которые не обрабатывались или не обрабатывались пятью типами дезинфицирующих средств, в основном включали Proteobacteria, Bacteroidetes, Actinobacteria и Firmicutes.Эти типы доминировали после обработки озоном, доступным хлором, глутаровым альдегидом и смешанным дезинфицирующим средством с относительной численностью 99,0, 97,9, 99,8 и 99,9% соответственно. Воздушно-десантные микроорганизмы в необработанных или обработанных дезинфицирующими средствами бройлерных птичниках различались на уровне типов. Всего в необработанном птичнике было отмечено 32 типа, в то время как количество типов в птичниках, обработанных озоном, активным хлором, четвертичной аммониевой солью, глутаровым альдегидом и смешанным дезинфицирующим средством, составляло 21, 27, 28, 17 и 6 соответственно. .Относительное количество OTU было самым низким после использования смешанного дезинфицирующего средства.

РИСУНОК 3. Таксономический состав сообщества и распределение численности на уровне типа (A) и уровне рода (B) . а, озон; б, доступный хлор; c, четвертичная аммониевая соль; г, глутаровый альдегид; д, смешанное дезинфицирующее средство; ф, без дезинфекции.

Всего на уровне рода было обнаружено 312 бактерий (рис. 3В). Из них в пустом помещении без дезинфектанта выявлено 218 родов бактерий, тогда как в бройлерных птичниках, обработанных озоном, доступным хлором, четвертичной аммониевой солью, глутаровым альдегидом и смешанными дезинфектантами, количество родов бактерий было 140, 230, 213, 114, и 60 соответственно.После обработки разными дезинфицирующими средствами структура распределения родов бактерий в бройлерных птичниках различалась. После применения смешанного дезинфицирующего средства относительная численность условно-патогенных микроорганизмов, таких как Escherichia-Shigella , Bacillus и Pseudomonas , значительно снизилась по сравнению с таковой до дезинфекции.

Анализ разнообразия микробных сообществ

Индекс Chao1, индекс ACE, индекс Шеннона и индекс Симпсона использовались для оценки обилия и разнообразия микробных видов в образцах (таблица 3).Показатели разнообразия разных выборок различались. Индекс разнообразия необработанного бройлерного птичника был выше, чем индексы других птичников, что указывает на то, что биоразнообразие необработанных бройлерных птичников было относительно богатым. Однако после обработки смешанным дезинфицирующим средством индексы обилия Chao 1 и ACE образцов из птичника снизились по сравнению с другими образцами. Самый низкий индекс разнообразия был отмечен для смешанного дезинфицирующего средства, что свидетельствует о том, что его дезинфицирующая эффективность выше, чем у других дезинфицирующих средств.Кроме того, анализ основных координат (PCoA) показал отчетливую кластеризацию отдельных образцов, а образец из необработанного дома был сгруппирован вместе и отделен от образцов других обработанных домов (дополнительный рисунок S1).

ТАБЛИЦА 3. Статистический анализ альфа-разнообразия бактерий в образцах.

Кластерный анализ

Тепловая карта (рис. 4) была построена на основе 35 различных таксономий, которые можно классифицировать на уровне типов.Каждая маленькая ячейка на диаграмме представляет относительную численность определенного типа бактерий в образце. Более интенсивный красный цвет представляет увеличение относительной численности. Как показано на тепловой карте, состав микробных сообществ в разных образцах различался. Обилие микробных сообществ в воздухе необработанного бройлерного птичника было самым высоким, и это количество, очевидно, уменьшилось после обработки комбинацией нескольких дезинфицирующих средств.

РИСУНОК 4. Относительная численность бактерий на уровне типа. а, озон; б, доступный хлор; c, четвертичная аммониевая соль; г, глутаровый альдегид; д, смешанное дезинфицирующее средство; ф, без дезинфекции. Тепловая карта имеет цветовую кодировку на основе строк Z -баллов. Шкала бара представляла собой стандартизированное значение Z относительного процентного содержания бактерий в шести образцах. Цветовой код указывает относительное обилие в диапазоне от синего (низкое обилие) до желтого и красного (высокое обилие).

Обсуждение

В этом исследовании технология высокопроизводительного секвенирования 16S рРНК в сочетании с пробоотборником микробных аэрозолей Andersen-6 (Andersen, 1958; Dalphin et al., 1991; Голофит-Шимчак и Горный, 2010 г.; Wu et al., 2017) использовали для углубленного изучения влияния различных дезинфицирующих средств на концентрацию бактериальных аэрозолей; дополнительно косвенно оценивали эффективность дезинфицирующих средств и риск вреда микробных аэрозолей для людей и скота. После дезинфекции сравнивали количество колоний в культуре аэрозольных бактерий. Результаты показывают, что концентрация бактериального аэрозоля была наименьшей после дезинфекции смешанным дезинфицирующим средством.Таким образом, аэрозольный спрей смешанного дезинфицирующего средства имел наилучшую эффективность. Другие продукты, ранжированные в порядке эффективности для бактерий, содержали глутаровый альдегид, четвертичную аммониевую соль, озон и доступный хлор. Судьба и др. (1985) использовали четыре коммерческих дезинфицирующих средства в птичнике для оценки эффективности бактериальной дезинфекции. Исследование Fate et al. (1985) показали, что наиболее эффективным дезинфицирующим средством для уменьшения количества колоний бактерий был продукт, содержащий глутаровый альдегид, по сравнению с продуктами, содержащими крезиловую кислоту, йодофоры и комбинацию четвертичного аммониевого соединения и формальдегида.Наши результаты также показывают, что глутаровый альдегид обладает хорошей эффективностью при дезинфекции бактерий. Смешанное дезинфицирующее средство содержало не только альдегиды, но и четвертичную аммониевую соль, и спирт. Это исследование показало, что эффект смешанного дезинфицирующего средства превосходит эффект одного дезинфицирующего средства. Эти результаты показывают, что смешанное дезинфицирующее средство оказывает значительное влияние на переносимые по воздуху бактерии, демонстрируя очевидное значение для стандартизации использования дезинфицирующих средств.

В настоящее время высокопроизводительные методы 16S рРНК в основном используются для анализа микробных сообществ в кишечнике человека и редко применяются для анализа структуры микробных сообществ микробного аэрозоля в животноводческих и птицеводческих помещениях.Анализ структуры микробных сообществ в пустующих птичниках после обработки пятью видами дезинфицирующих средств показал, что дезинфицирующие средства способны эффективно снижать микробиологическое разнообразие и распространение микроорганизмов в птичниках бройлеров. На уровне родов и видов количество выявленных OTU сократилось. Эффект от комбинации нескольких дезинфицирующих средств был наиболее очевидным, за ним следовал глутаровый альдегид, а эффект доступного хлора был наихудшим. Этот вывод в первую очередь связан с тем, что на дезинфекцию хлорсодержащего дезинфицирующего средства легко влияют концентрации доступного хлора и факторы окружающей среды, включая pH, температуру и органические вещества (Russell, 1990; Frais et al., 2001; Россифеделе и др., 2011; Фрейзер и др., 2013). Таким образом, обеззараживающий эффект был неустойчивым. Смешанное дезинфицирующее средство представляло собой комбинацию альдегида, спирта и соли четвертичного аммония. Смешанное дезинфицирующее средство проявляло широкий антибактериальный спектр, сильную бактерицидную способность и усиленный дезинфицирующий эффект.

Эффективное дезинфицирующее средство может дезинфицировать птичник и окружающую среду и защищать от всех вирусов (с оболочкой и без оболочки), бактерий, бактериальных спор и грибков.Высокопроизводительная технология является наиболее прямым методом оценки бактерицидного действия дезинфицирующих средств при изучении структуры бактериального сообщества в воздухе обрабатываемых бройлерных помещений. Clostridium и Bacillus являются основными родами бактерий, образующими споры. Учитывая, что бактериальные споры имеют толстую стенку, большинство дезинфицирующих средств малоэффективны. Борик (Borick et al., 1964) и Старке (Stark et al., 1975) обнаружили, что глутаровый альдегид способен убивать споры Bacillus и Clostridium spp.в течение 3 ч. Результаты этого исследования показали, что среди пяти типов дезинфицирующих средств глутаровый альдегид и смешанное дезинфицирующее средство могут эффективно очищать Clostridium , и бактерии этого рода не обнаружены (дополнительная таблица S2). Наихудшее бактерицидное действие на спорообразующие бактерии оказывала четвертичная аммониевая соль, при обнаруженной концентрации в воздухе 0,16%. Bacillus не обнаружен в воздухе бройлерного помещения, обработанного смешанным дезинфицирующим средством. Глутаровый альдегид показал вторую самую низкую концентрацию при 0.045%, тогда как в бройлерном помещении, продезинфицированном солью четвертичного аммония, была самая высокая концентрация – 5,11%. Причина, по которой смешанное дезинфицирующее средство оказалось более эффективным, чем глутаровый альдегид, может заключаться в других соединениях. Пеппер и Чандлер (1963) обнаружили, что глутаровый альдегид в спиртовом растворе в качестве спороцидного агента превосходит как формальдегид, так и глиоксаль. Поскольку смешанное дезинфицирующее средство содержит альдегиды и спирт, оно может иметь лучший стерилизующий эффект. Наши результаты показали, что комбинация нескольких дезинфицирующих средств оказывает наилучшее бактерицидное действие на спорообразующие бактерии, за которым следует глутаровый альдегид, тогда как четвертичная аммониевая соль оказывает наихудшее дезинфицирующее действие на спорообразующие бактерии.

В бактериальном аэрозоле содержится много условно-патогенных микроорганизмов. Выбор разумных дезинфицирующих средств может эффективно блокировать распространение условно-патогенных бактерий. Ochrobactrum , Escherichia-Shigella и Bacillus являются тремя распространенными условно-патогенными микроорганизмами. После обработки птичников различными дезинфицирующими средствами Ochrobactrum и Bacillus не были обнаружены в образцах из птичника, обработанного смешанным дезинфицирующим средством (дополнительная таблица S2).Во-вторых, уровни этих трех бактерий после дезинфекции глутаровым альдегидом значительно снизились по сравнению с уровнями после обработки другими дезинфицирующими средствами. Ochrobactrum и Escherichia-Shigella являются грамотрицательными патогенными бактериями, а Bacillus является грамположительной бактерией. Эти результаты показали, что смешанное дезинфицирующее средство оказывает лучший дезинфицирующий эффект на условно-патогенные микроорганизмы, будь то грамотрицательные или грамположительные бактерии.

Устойчивость бактерий к дезинфицирующим средствам также была в центре внимания исследований в последние годы.Самая ранняя обнаруженная резистентная бактерия — условный патоген Pseudomonas , проявляющий устойчивость к различным дезинфицирующим средствам, включая четвертичную аммониевую соль, ацетат хлоргексидина, йод и фенол (Gilbert and Brown, 1978; Craven et al., 1981; Brozel and Cloete). , 1993). Результаты этого исследования показали, что комбинация дезинфицирующих средств оказывает наилучшее дезинфицирующее действие на Pseudomonas , за которым следует глутаровый альдегид. Влияние четвертичной аммониевой соли было наихудшим.Предыдущие исследования показали, что устойчивость бактерий постепенно увеличивается при использовании дезинфицирующего средства. Однако после перехода на другие дезинфицирующие средства эта резистентность исчезнет. Это исследование также продемонстрировало, что комбинация нескольких дезинфицирующих средств может преодолеть устойчивость бактерий к одному дезинфицирующему средству во время дезинфекции дома. В доме, обработанном смешанным дезинфицирующим средством Planctomycetes , Acidobacteria и Gemmatimonadetes , были полностью уничтожены, тогда как другие дезинфицирующие средства не уничтожали полностью эти бактерии.На уровне рода в птичнике, обработанном смешанным дезинфицирующим средством, наблюдалось полное уничтожение Bacillus , Arenimonas , Shinella .

Хотя ингредиенты смешанного дезинфицирующего средства были широко используемыми дезинфицирующими средствами, их концентрации и методы, используемые в процессе дезинфекции, должны быть изучены в зависимости от условий фермы для достижения дезинфекции при одновременном снижении лекарственной устойчивости. Кроме того, мы анализировали образец ДНК бактерий в воздухе, тогда как анализ последовательности не делает различий между живыми и мертвыми бактериями.В результате при проведении секвенирования некоторые ОТЕ могут оказаться в доме, обработанном дезинфицирующим средством. Эти OTU не появлялись в необработанном доме. Эти бактерии с низкой численностью могут иметь значение для точности анализа данных. Поэтому крайне важен поиск новых подходов для точной оценки изменений структуры микробных консорциумов. Результаты показали, что исследования и разработки смешанных дезинфицирующих средств следует постоянно укреплять, чтобы улучшить спектр дезинфекции, уменьшить дозировку и повысить безопасность для персонала и животных.

Вклад авторов

XXZ и LJ разработали эксперименты. LJ, JT, ML и XYZ провели эксперименты. JZ, YL и TF проанализировали результаты эксперимента. LJ, HZ и XY написали рукопись.

Финансирование

Данное исследование выполнено при финансовой поддержке Национального проекта по профилактике и борьбе с трансграничными болезнями животных, Национальной ключевой программы НИОКР на 13-ю пятилетку Министерства науки и технологий Китая (грант №2017YFD0501800), Ключевой план исследований и разработок провинции Шаньдун (Грант № 2017NC210009), Проект инновационной группы для современной сельскохозяйственной промышленной технологической системы провинции Шаньдун (Грант № SDAIT-11-10) и Проект внедрения талантов Лудун Университет (грант № LY2014019).

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2018.02113/full#supplementary-material

.

Сноски

  1. http://greengenes.secondgenome.com
  2. http://sourceforge.net/projects/rdp-classifier/

Каталожные номера

Андерсен, А.А. (1958). Новый пробоотборник для сбора, определения размера и подсчета жизнеспособных частиц в воздухе. J. Бактериол. 76, 471–484.

Реферат PubMed | Академия Google

Барбоза, Ф. О., Фрейтас, О. Н., Батиста, Д., Алмейда, А. М., Рубио, М., Алвес, Л., и др. (2017). Вклад жгутиков и подвижности в колонизацию кишечника и патогенность Salmonella Enteritidis у кур. Браз. Дж. Микробиол. 48, 754–759. doi: 10.1016/j.bjm.2017.01.012

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Баттерсби, Т., Уолш Д., Уайт П. и Болтон Д. (2017). Оценка и улучшение методов терминальной гигиены на бройлерных фермах для предотвращения перекрестного заражения Campylobacter между стадами. Пищевой микробиол. 64, 1–6. doi: 10.1016/j.fm.2016.11.018

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Берг, Дж. Д., Робертс, П. В., и Матин, А. (2010). Влияние диоксида хлора на отдельные функции мембран Escherichia coli . Дж. Заявл.бактериол. 60, 213–220. doi: 10.1111/j.1365-2672.1986.tb01075.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бессарабов Б.Ф., Дьяконова Е.В., Пущин Н.И., Резвых А.Г., Мотылев В.Ф. (1972). Микробное загрязнение воздуха в птичниках. Ветеринария 8, 28–30.

Реферат PubMed | Академия Google

Борик П.М., Дондершайн Ф.Х. и Чандлер В.Л. (1964). Алкалинизированный глутаровый альдегид, новый антимикробный агент. Дж. Фарм. науч. 53, 1273–1275. doi: 10.1002/jps.2600531041

Полнотекстовая перекрестная ссылка | Академия Google

Боксалл, Н.С., Перкинс, Н.Р., Маркс, Д., Джонс, Б., Фенвик, С.Г., и Дэвис, П.Р. (2003). Свободный доступный хлор в коммерческой питьевой воде для цыплят-бройлеров в Новой Зеландии. J. Food Prot. 66, 2164–2167. дои: 10.4315/0362-028X-66.11.2164

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Брантнер, К.А., Ханна, Р.М., Буранс, Дж. П., и Поуп, Р. К. (2014). Инактивация и ультраструктурный анализ Bacillus spp. и споры Clostridium perfringens . Микроск. Микроанал. 20, 238–244. дои: 10.1017/S1431

3013949

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Брозель, В.С., и Клоете, Т.Е. (1993). Адаптация Pseudomonas aeruginosa к 2,2′-метиленбис (4-хлорфенолу). Дж. Заявл. бактериол. 74, 94–99.doi: 10.1111/j.1365-2672.1993.tb03001.x

Полнотекстовая перекрестная ссылка | Академия Google

Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., et al. (2010). QIIME позволяет анализировать данные секвенирования с высокой пропускной способностью. Нац. Методы 7, 335–336. doi: 10.1038/nmeth.f.303

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Карвалью, М. Р., Да Силва, М. А., Брито, К. А., Кампело, В., Куга, М.C., Tonetto, M.R., et al. (2015). Сравнение антимикробной активности химических дезинфицирующих средств на загрязненных ортодонтических щипцах. Дж. Контемп. Вмятина. Практика. 16, 619–623. doi: 10.5005/jp-journals-10024-1731

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кастро Бурбарелли, М.Ф., До Валье Поликарпо, Г., Делиберали Лелис, К., Грангелли, К.А., Карао де Пиньо, А.К., Рибейро Алмейда Кейрос, С., и др. (2017). Программы очистки и дезинфекции против Campylobacter jejuni для цыплят-бройлеров: производительность, микробиологическая оценка и характеристика. Поулт. науч. 96, 3188–3198. doi: 10.3382/ps/pex153

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чен, К., Ан, X., Ли, Х., Су, Дж., Ма, Ю. и Чжу, Ю. Г. (2016). Длительное применение осадка сточных вод в полевых условиях увеличивает количество генов устойчивости к антибиотикам в почве. Окружающая среда. Междунар. 9, 1–10. doi: 10.1016/j.envint.2016.03.026

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чен, К. Л., Ан, С. Л., Чжу, Ю.G., Su, J.Q., Gillings, M.R., Ye, Z.L., et al. (2017). Применение струвита изменяет резистентность антибиотика в почве, ризосфере и филлосфере. Окружающая среда. науч. Технол. 51, 8149–8157. doi: 10.1021/acs.est.7b01420

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чидамбаранатан, А.С., и Баласубраманиум, М. (2017). Всесторонний обзор и сравнение методов дезинфекции, доступных в настоящее время в литературе. J. Протезирование. doi: 10.1111/jopr.12597 [Epub перед печатью].

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Craven, D.E., Moody, B., Connolly, M.G., Kollisch, N.R., Stottmeier, K.D., и McCabe, W.R. (1981). Псевдобактериемия, вызванная раствором повидон-йода, зараженным Pseudomonas cepacia . Н. англ. Дж. Мед. 305, 621–623. дои: 10.1056/NEJM1981051106

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Дальфин, Дж.C., Pernet, D., Reboux, G., Martinez, J., Dubiez, A., Barale, T., et al. (1991). Влияние режима хранения и сушки кормов на аэроконтаминацию термофильными актиномицетами молочных ферм региона Ду во Франции. Грудная клетка 46, 619–623. doi: 10.1136/thx.46.9.619

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Delgadoroche, L., Rieraromo, M., Mesta, F., Hernándezmatos, Y., Barrios, J.M., Martinezsánchez, G., et al. (2017). Медицинский озон способствует фосфорилированию Nrf2, уменьшая окислительный стресс и провоспалительные цитокины у пациентов с рассеянным склерозом. евро. Дж. Фармакол. 811, 148–154. doi: 10.1016/j.ejphar.2017.06.017

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Эдгар, Р. К., Хаас, Б. Дж., Клементе, Дж. К., Айва, К., и Найт, Р. (2011). UCHIME повышает чувствительность и скорость обнаружения химер. Биоинформатика 27, 2194–2200. doi: 10.1093/биоинформатика/btr381

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Судьба, Массачусетс, Скилз, Дж. К., Уитфилл, К.Э. и Рассел, И. Д. (1985). Оценка четырех дезинфицирующих средств в условиях выращивания птицы с использованием метода отбора проб контактного агара. Поулт. науч. 64, 629–633. doi: 10.3382/ps.0640629

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Frais, S., Ng, Y.L., and Gulabivala, K. (2001). Некоторые факторы, влияющие на концентрацию подвижного хлора в коммерческих источниках гипохлорита натрия. Междунар. Эндод. Дж. 34, 206–215. doi: 10.1046/j.1365-2591.2001.00371.х

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Frazer, A.C., Smyth, J.N., and Bhupathiraju, V.K. (2013). Спорицидная эффективность отбеливателя с отрегулированным рН для контроля бионагрузки на поверхностях производственных помещений. J. Ind. Microbiol. Биотехнолог. 40, 601–611. doi: 10.1007/s10295-013-1257-7

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Гилберт П. и Браун М. Р. (1978). Влияние скорости роста и ограничения питательных веществ на общий клеточный состав Pseudomonas aeruginosa и его устойчивость к 3- и 4-хлорфенолу. J. Бактериол. 133,1066–1072.

Реферат PubMed | Академия Google

Голофит-Шимчак, М., и Горный, Р.Л. (2010). Бактериальные и грибковые аэрозоли в офисных зданиях с кондиционерами в Варшаве, Польша – зимний сезон. Междунар. Дж. Оккуп. Саф. Эргон. 16, 465–476. дои: 10.1080/10803548.2010.11076861

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Го, Н., Ван, Ю., Тонг, Т., и Ван, С. (2018). Судьба генов антибиотикорезистентности и их потенциальных хозяев при биоэлектрохимической очистке высокоминерализованных фармацевтических сточных вод. Вода Res. 133, 79–86. doi: 10.1016/j.waters.2018.01.020

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хакуно Х., Ямамото М., Ойе С. и Камия А. (2010). Микробная контаминация дезинфицирующих средств, используемых для периодической самокатетеризации. Япония. Дж. Заразить. Дис. 63, 277–279.

Реферат PubMed | Академия Google

Hojovec, J., and Fiser, A. (1968). Микрофлора атмосферы в птичниках для бройлеров. Дтч. Tierärztl. Wochenschr. 75 483–486.

Реферат PubMed | Академия Google

Джейкобс, В.А., и Гейдельбергер, М. (1915). О новой группе бактерицидных веществ, полученных из гексаметилентетрамина. Проц. Натл. акад. науч. США 1, 226–228. doi: 10.1073/pnas.1.4.226

Полнотекстовая перекрестная ссылка | Академия Google

Цзя Х.Р., Гэн Л.Л., Ли Ю.Х., Цян В., Дяо К.Ю., Чжоу Т. и др. (2016). Влияние токсина Bt Cry1Ie на бактериальное разнообразие в средней кишке Apis mellifera ligustica (Hymenoptera: Apidae). науч. Реп. 6:24664. дои: 10.1038/srep24664

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Джаст, Н., Блейс, Л.П., Маркувуазель, М., Киричук, С., Вейетт, М., Сингх, Б., и соавт. (2011а). Археальная характеристика биоаэрозолей при клеточном и напольном птицеводстве. Окружающая среда. Рез. 111, 492–498. doi: 10.1139/cjm-2012-0305

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Юст Н., Киричук С., Gilbert, Y., Letourneau, V., Veillette, M., Singh, B., et al. (2011б). Характеристика бактериального разнообразия биоаэрозолей при клеточном и напольном птицеводстве. Окружающая среда. Рез. 111, 492–498. doi: 10.1016/j.envres.2011.01.009

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Korajkic, A., Parfrey, L.W., Mcminn, B.R., Baeza, Y.V., Vanteuren, W., Knight, R., et al. (2015). Изменения бактериального и эукариотического сообществ при разложении сточных вод в речной воде Миссисипи. Вода Res. 69, 30–39. doi: 10.1016/j.waters.2014.11.003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кучински, Дж., Стобо, Дж., Уолтерс, В.А., Гонсалес, А., Капорасо, Дж.Г., и Найт, Р. (2011). Использование QIIME для анализа последовательностей генов 16S рРНК из микробных сообществ. Курс. протокол Биоинформатика 36, 10.7.1–10.7.20. дои: 10.1002/0471250953.bi1007s36

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лю, Дж., Ян В., Чжан Х. и Ву Ю. (2006). Влияние диоксида хлора на содержание хлорофилла а, белков и ДНК в Phaeocystis globosa. Дж. Троп. субтроп. Бот. 14, 427–432.

Академия Google

Maertens, H., De, R.K., Van, W.S., Van, C.E., Meyer, E., Van, M.H., et al. (2017). Оценка гигиенических показателей и связанных с ними данных, полученных после очистки и дезинфекции птичников во Фландрии в период с 2007 по 2014 год. Poult. науч. 97, 620–627.doi: 10.3382/ps/pex327

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Магоч, Т., и Зальцберг, С.Л. (2011). FLASH: быстрая корректировка длины коротких ридов для улучшения сборки генома. Биоинформатика 27, 2957–2963. doi: 10.1093/биоинформатика/btr507

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Майтан, В., и Майтанова, Л. (1999). Влияние новых дезинфицирующих веществ на метаболизм Enterobacter cloacae . Междунар. Дж. Антимикроб. Агенты 11, 59–64. doi: 10.1016/S0924-8579(98)00083-1

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Меллата, М. (2013). Человеческая и птичья внекишечная патогенная Escherichia coli : инфекции, зоонозные риски и тенденции устойчивости к антибиотикам. Патог пищевого происхождения. Дис. 10, 916–932. doi: 10.1089/fpd.2013.1533

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Майнер, Н., Харрис, В., Эброн, Т., и Цао, Т.Д. (1993). Спороцидная активность дезинфицирующих средств как одна из возможных причин появления бактерий в готовых к использованию эндоскопах. Гастроэнтерол. Нурс. 30, 285–290. doi: 10.1097/01.SGA.0000287201.98483.43

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мур, Г., Гриффит, К., и Питерс, А. (2000). Бактерицидные свойства озона и возможности его применения в качестве терминального дезинфицирующего средства. J. Food Prot. 63, 11:00–11:06. doi: 10.4315/0362-028X-63.8.1100

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мугини-Грас, Л., Энсеринк, Р., Фризема, И., Хек, М., Дуйнховен, Ю.В., и Пелт, В.В. (2014). Факторы риска сальмонеллеза человека, происходящие от свиней, крупного рогатого скота, цыплят-бройлеров и кур-несушек: комбинированный анализ случай-контроль и определение источника. PLoS One 9:e87933. doi: 10.1371/journal.pone.0087933

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Муньос, М., Гутье С., Фуко С., Марио Г. и Пуарье Т. (2017). Прогнозирование размера капель при ультразвуковом распылении для синтеза неоксидного керамического порошка. Ультразвук 84, 25–33. doi: 10.1016/j.ultras.2017.10.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

О’Брайен, К.Л., Павли, П., Гордон, Д.М., и Эллисон, Г.Э. (2014). Обнаружение бактериальной ДНК в лимфатических узлах больных болезнью Крона с помощью высокопроизводительного секвенирования. Гут 63, 1596–1606.doi: 10.1136/gutjnl-2013-305320

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Озтюрк Б., Куртоглу Т., Дурмаз С., Козачи Л. Д., Абаджигил Ф., Эртугрул Б. и др. (2017). Влияние озона на рост бактерий и тиолдисульфидный гомеостаз при инфекции сосудистого трансплантата, вызванной MRSA у крыс. Акта Хирург. Бюстгальтеры. 32, 219–228. дои: 10.1590/S0102-865020170030000006

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Перец, Р.Э. и Чендлер В.Л. (1963). Спороцидная активность щелочных спиртовых насыщенных растворов диальдегидов. Заяв. микробиол. 11, 384–388.

Реферат PubMed | Академия Google

Петков Г. и Байков Б. Д. (1984). Микробный состав воздуха в птичниках. Вет. Мед. Науки 21, 123–130.

Академия Google

Петков Г., Байков Б. Д. и Руссак Г. (1987). Возможности обеззараживания воздуха в товарном птицеводстве. Вет. Мед. Науки 24, 67–72.

Реферат PubMed | Академия Google

Петков Г. и Цуцумански В. (1975). Загрязнение воздуха микроорганизмами на различных расстояниях от птичника. Вет. Мед. Науки 12, 15–20.

Реферат PubMed | Академия Google

Поулсен, Л.Л., Тофнер, И., Бисгаард, М., Кристенсен, Дж.П., Олсен, Р.Х., и Кристенсен, Х. (2017). Продольное исследование передачи Escherichia coli от производителей бройлеров к бройлерам. Вет. микробиол. 207, 13–18. doi: 10.1016/j.vetmic.2017.05.029

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Россифеделе Г., Гуасталли А. Р., Дограмачи Э. Дж., Штайер Л. и Де Фигейредо Дж. А. (2011). Влияние изменения рН на хлорсодержащие эндодонтические ирригационные растворы. Междунар. Эндод. Дж. 44, 792–799. doi: 10.1111/j.1365-2591.2011.01911.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Рассел, А.Д. (1990). Бактериальные споры и химические спороциды. клин. микробиол. Ред. 3, 99–119. doi: 10.1128/CMR.3.2.99

Полнотекстовая перекрестная ссылка | Академия Google

Рутала, В. А., Герген, М. Ф., и Вебер, Д. Дж. (1993). Инактивация спор Clostridium difficile дезинфицирующими средствами. Заразить. Хосп. Эпидемиол. 14, 36–39. дои: 10.2307/30146511

Полнотекстовая перекрестная ссылка | Академия Google

Саклоу, Н. Т., Берджесс, Б. А., Ван Метре, Д.К., Хорниг, К.Дж., Морли, П.С., и Байерс, С.Р. (2016). Сравнение эффективности дезинфицирующих средств при использовании направленного распыления больших объемов ускоренных дезинфицирующих средств перекиси водорода и пероксимоносульфата в крупной ветеринарной больнице. Ветеринар по лошадям. Дж. 48, 485–489. doi: 10.1111/evj.12476

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Старк Р.Л., Фергюсон П., Гарза П. и Майнер Н.А. (1975). Оценка ассоциации официальных химиков-аналитиков методом спороцидного теста. Дев. инд. микробиол. 16, 31–36.

Академия Google

Stromberg, Z.R., Johnson, J.R., Fairbrother, J.M., Kilbourne, J., Van, G.A., Rd, C.R., et al. (2017). Оценка изолятов Escherichia coli от здоровых кур для определения их потенциального риска для здоровья птицы и человека. PLoS One 12:e0180599. doi: 10.1371/journal.pone.0180599

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сува, М., Ойе, С.и Фурукава, Х. (2013). Эффективность дезинфицирующих средств против встречающихся в природе и искусственно культивируемых бактерий. биол. фарм. Бык. 36, 360–363. doi: 10.1248/bpb.b12-00721 ​​

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Threlfall, E.J., Wain, J., Peters, T., Lane, C., Pinna, E.D., Little, C.L., et al. (2014). Переносимые яйцами инфекции человека Salmonella : проблема не только S. enteritidis . Мировой цыпленок.науч. Дж. 70, 15–26. дои: 10.1017/S00439330026

Полнотекстовая перекрестная ссылка | Академия Google

Tian, ​​X., Shi, Y., Geng, L., Chu, H., Zhang, J., Song, F., et al. (2017). Подготовка матрицы влияет на высокопроизводительный анализ секвенирования 16S рРНК микробных сообществ филлосферы. Фронт. Растениевод. 8:1623. doi: 10.3389/fpls.2017.01623

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ван Клингерен, Б. (1995). Тестирование дезинфицирующих средств на поверхностях. Дж. Хосп. Заразить. 30, 397–408. дои: 10.1016/0195-6701(95)-6

Полнотекстовая перекрестная ссылка | Академия Google

Венкобачар, К., Айенгар, Л., и Рао, А.В.С.П. (1977). Механизм обеззараживания: действие хлора на функции клеточных мембран. Вода Res. 11, 727–729. дои: 10.1016/0043-1354(77)

-2

Полнотекстовая перекрестная ссылка | Академия Google

Винаянанда, К.О., Файрозе, Н., Мадхавапрасад, К.Б., Байреговда, С.М., Нагарадж, К.С., Багалкот П. и др. (2017). Исследования по обнаружению, характеристике и обеззараживанию возникающих патогенных Escherichia coli (STEC, ETEC и EIEC) в столовых яйцах. руб. Поулт. науч. 58, 664–672. дои: 10.1080/00071668.2017.1373387

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Вирто Р., Маньяс П., Иварес И., Кондон С. и Расо Дж. (2005). Повреждение мембраны и микробная инактивация хлором в отсутствие и в присутствии требовательного к хлору субстрата. Заяв. Окружающая среда. микробиол. 71, 5022–5028. doi: 10.1128/AEM.71.9.5022-5028.2005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Wichelhaus, A., Bader, F., Sander, F.G., Krieger, D., and Mertens, T. (2006). Эффективная дезинфекция ортодонтических щипцов. Дж. Орофак. Ортоп. 67, 316–336. doi: 10.1007/s00056-006-0622-9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ву Б., Мэн К., Вэй Л., Цай Ю. и Чай Т.(2017). Сезонные колебания микробного аэрозоля на рынках живой птицы и обнаружение эндотоксина. Фронт. микробиол. 8:551. doi: 10.3389/fmicb.2017.00551

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ву, Г., Эрихт, Р., Мафура, М., Стоукс, М., Смит, Н., Причард, Г.С., и соавт. (2012). Escherichia coli , изоляты из внекишечных органов сельскохозяйственных животных, содержат различные гены вирулентности и принадлежат к нескольким генетическим линиям. Вет. микробиол. 160, 197–206. doi: 10.1016/j.vetmic.2012.05.029

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сравнение эффективности натуральных и синтетических биоцидов для дезинфекции поверхностей из силикона и нержавеющей стали | Патогены и болезни

Необходимы новые биоцидные растворы для эффективной борьбы с эволюцией микробов, развивающих устойчивость к антибиотикам, с низким или нулевым воздействием на окружающую среду.Эта работа направлена ​​на оценку эффективности обычно используемых биоцидов и соединений на природной основе при дезинфекции поверхностей из силикона и нержавеющей стали (SS), зараженных различными штаммами Staphylococcus aureus . Минимальную ингибирующую концентрацию определяли для синтетических (бензалкония хлорид-БАЦ, глутаральдегид-ГТА, орто--фталальдегид-ОПА и надуксусная кислота-ПАА) и натуральных (куминальдегид-КУМ), эвгенол-ЭУГ и индол-3-карбинол- I3C) биоцидов методом микроразведений.Эффективность выбранных биоцидов при MIC, 10 × MIC и 5500 мг/л (репрезентативная концентрация при использовании) при дезинфекции сидячих S. aureus на силиконе и SS оценивали путем подсчета жизнеспособности. Силиконовые поверхности было труднее дезинфицировать, чем SS. GTA, OPA и PAA приводили к полному снижению КОЕ сидячих клеток для всех испытуемых концентраций, а также BAC при 10 × MIC и 5500 мг/л. CUM был наименее эффективным соединением. EUG был эффективен для дезинфекции SS, независимо от испытанных штаммов и концентраций.I3C при 10 × MIC и 5500 мг/л был способен вызывать общее снижение количества КОЕ бактерий, отложившихся в силиконе и SS. Хотя биоциды на природной основе не так эффективны, как синтетические соединения, они перспективны для использования в дезинфицирующих препаратах, особенно I3C и EUG.

ВВЕДЕНИЕ

О роли загрязненных поверхностей и медицинских устройств в передаче патогенов, связанных со здравоохранением, хорошо известно (Kramer, Schwebke and Kampf 2006; Boyce 2007; Weber et al. 2010; Выдра и др. 2015). Ряд исследований показывает, что микробное загрязнение этих поверхностей и устройств играет важную роль в распространении патогенов (Weinstein and Hota 2004; Gebel et al. 2013; Otter et al. 2015). Эффективная передача патогенов зависит от нескольких факторов, включая способность микроорганизмов сохранять жизнеспособность на сухих поверхностях, их устойчивость к дезинфицирующим средствам и частоту контакта зараженных поверхностей или устройств с пациентами и медицинскими работниками (Boyce 2007; Weber et al. 2010). Чтобы предотвратить приобретение и распространение инфекций, связанных с оказанием медицинской помощи (HAI), важно внедрить адекватные и эффективные протоколы очистки и дезинфекции. ИСМП связаны с высокой заболеваемостью и смертностью для пациентов и финансовым бременем для медицинских учреждений. Поэтому необходимы эффективные стратегии дезинфекции поверхностей и устройств в больницах (Abreu et al. , 2013 г.). Однако устойчивость бактерий к дезинфицирующим средствам является важным фактором в борьбе с ИСМП.Микроорганизмы могут иметь внутреннюю/врожденную устойчивость к дезинфицирующим средствам, которая обычно связана с клеточной непроницаемостью. Однако постоянное воздействие дезинфицирующих средств может повысить устойчивость микробов за счет клеточных мутаций или приобретения генетических элементов (Abreu et al. 2013; Russel 1998). Соединения четвертичного аммония, бигуаниды и фенолы, особенно используемые в ряде биоцидных продуктов в здравоохранении, связаны с появлением устойчивости бактерий in vitro (Russell, Suller and Maillard 1999; Maillard 2005; SCENIHR 2009).Например, исследования сообщили о псевдомонас Aeruginosa, Listeria monocytogenes и Staphylococcus aureus с низкой восприимчивостью к хлористу бензалкония (BAC) (Sakagami et al. 1989; Akimitsu et al. 1999; до et al. 2002 ; Bridier и др. 2011; Ibusquiza, Herrera and Cabo 2011). Также сообщалось об устойчивости бактерий к дезинфицирующим средствам высокого уровня, таким как окисляющие и алкилирующие агенты, например, устойчивость к надуксусной кислоте (ПАА) в л.Моноцитогены (Bridier et al. 2011; ibusquiza, herrera and cabo 2011) и вегетативные bacillus subtilis (Bridier et al. 2012), Mycobacterium Avium и M. Terrae (Bridier et al. 2011) и устойчивость к глутаральдегиду (GTA) у атипичных микобактерий (Griffiths et al. 1997). Об устойчивости бактерий к OPA сообщили Fisher et al. (2012), который выделил M. gordonae и M.avium из эндоскопов, продезинфицированных ОРА. Это ясно говорит о том, что разработка новых дезинфицирующих растворов имеет первостепенное значение для эффективной профилактики ИСМП.

В этой работе три биоцида на природной основе, полученные в результате вторичного метаболизма растений (куминальдегид — ЦУМ, представленный в C. cyminum (Morshedi et al. 2015), эвгенол — ЭУГ, представленный в Syzygium flavorum — гвоздика (Just et al. 2016) и индол-3-карбинол-I3C, присутствующие в некоторых овощах рода Brassica , включая капусту, цветную и брюссельскую капусту (Bjeldanes et al .1991)) оценивали на предмет их потенциальной бактерицидной эффективности в отношении четырех штаммов S. aureus , высеянных на силикон или нержавеющую сталь, два поверхностных материала, обычно встречающихся в больницах (Ковалева и др. 2013; Гастмайер и Вонберг 2014). BAC, GTA, OPA и PAA использовали для сравнения активности.

МАТЕРИАЛЫ И МЕТОДЫ

Бактериальные штаммы

Staphylococcus aureus SA1199B, который сверхэкспрессирует эффлюксный насос NorA MDR, S.aureus RN4220, который содержит плазмиду pU5054 (несущий ген, кодирующий белок оттока макролидов MsrA), и S. aureus XU212, который обладает насосом оттока TetK и также является штаммом MRSA, были любезно предоставлены S. Gibbons ( Университетский колледж Лондона, UCL) (Oluwatuyi, Kaatz and Gibbons 2004; Smith et al. 2007). Коллекционный штамм S. aureus CECT 976, уже используемый в качестве модельного микроорганизма для антимикробных испытаний с фитохимическими соединениями (Saavedra et al. 2010; Абреу и др. 2012), был включен в качестве контрольного штамма.

Биоциды

Выбранные биоциды были приобретены у Sigma (Синтра, Португалия). Растворы БАК, ГТА, ПАК и ОФК готовили на стерильной дистиллированной воде. Растворы CUM, EUG и I3C готовили в диметилсульфоксиде (ДМСО, Sigma, Sintra, Portugal). ДМСО использовали в качестве отрицательного контроля, и в используемой концентрации (10% об./об.) он не ингибировал рост бактерий и не снижал количество КОЕ во всех четырех тестируемых штаммах.

Тестовые поверхности

Нержавеющая сталь ASI 316 (SS) и силиконовые образцы (1 × 1 см) были приобретены у (Neves & Neves, Муро, Португалия) и использовались в качестве тестовых поверхностей. Перед использованием купоны промывали коммерческим моющим средством (Sonasol, Henkel, Барселона, Испания) в течение 30 минут, а затем ополаскивали дистиллированной водой для удаления остатков моющего средства. Затем купоны погружали в этанол с концентрацией 70% (об./об.) на 1 час для уничтожения потенциальных микробных загрязнителей. Наконец, купоны промывали стерильной дистиллированной водой три раза подряд и хранили до тех пор, пока они не потребуются.Чтобы убедиться в отсутствии микробных загрязнений на поверхностях, 400 мкл 4,6-диамино-2-фенилиндола (DAPI) (Sigma, Синтра, Португалия) в концентрации 0,5 мкг/мл наносили на тестовую поверхность и оставляли в темноте на 5 мин (Lemos и др. , 2015 г.). Поверхности визуализировали под эпифлуоресцентным микроскопом (Leica DMLB2 с ртутной лампой HBO/100W/3), включающим ПЗС-камеру для получения изображений с использованием программного обеспечения IM50 (Leica, Хьюстон, США), с использованием масляного иммерсионного флуоресцентного объектива ×100 и фильтр, чувствительный к флуоресценции DAPI (фильтр возбуждения 359 нм в сочетании с фильтром излучения 461 нм).

Минимальная подавляющая концентрация

Минимальную ингибирующую концентрацию (МИК) каждого биоцида определяли методом микроразведений в бульоне в соответствии с CLSI (2012).

Бактериальная адгезия и дезинфекция поверхности Manolayer

Staphylococcus aureus выращивали в течение ночи в бульоне Muller Hinton (MH) (Merck, Darmstadt, Germany) при 30ºC при перемешивании со скоростью 150 об/мин (Agitorb 200, Aralab, Rio de Mouro, Portugal).Затем бактериальные суспензии центрифугировали (центрифуга Eppendorf 5810R, VWR, Carnaxide, Portugal) при 3777 g в течение 10 мин, дважды промывали физиологическим раствором (NaCl, 8,5 г/л) и ресуспендировали в физиологическом растворе до конечной концентрации 3 × 10 8 КОЕ/мл. Монослойную бактериальную адгезию в 48-луночных титрационных микропланшетах проводили в течение 2 ч в соответствии с Simões et al. (2007) и Meireles et al. (2015). Вкратце, в каждую лунку вертикально вставляли силиконовые или SS купоны и добавляли 1 мл бактериальной суспензии.Затем планшеты для микротитрования инкубировали при 30ºC и 150 об/мин. После 2-часовой инкубации купоны переносили на новые титрационные микропланшеты с NaCl (8,5 г/л) для удаления неадгезивных и слабоадгезивных бактерий (Meireles et al. 2015). Чтобы оценить, прилипли ли бактерии к поверхностям, образцы были подвергнуты микроскопическому анализу с помощью DAPI в соответствии с Lemos et al. (2015). Купоны вставляли в новые титрационные микропланшеты с выбранным биоцидом. Биоциды тестировали при различных концентрациях: МИК, 10 × МИК и концентрации, представляющей те, которые фактически применяются при дезинфекции в больницах (5500 мг/л, концентрация выше, чем МИК выбранных биоцидов, что соответствует используемой концентрации ОФА (Rutala). , Вебер и Комитет, 2008 г.).Бактерии, прилипшие к поверхностям, подвергались воздействию биоцидов в течение 30 мин. Согласно рекомендациям CDC по дезинфекции медицинских учреждений, время воздействия для дезинфекции высокого уровня должно составлять не менее 12 минут в зависимости от соединения (Rutala, Weber and Committee 2008). Принимая во внимание, что соединения на природной основе не так эффективны, как дезинфицирующие средства высокого уровня (были получены более высокие значения MIC), после предыдущих исследований с фитохимическими веществами и синтетическими биоцидами использовалась 30-минутная экспозиция (Simões et al. 2006 г.; Лемос и др. 2015). После воздействия биоцида купоны осторожно промывали в другом титрационном микропланшете физиологическим раствором. Эту процедуру повторяли дважды, чтобы снизить уровень биоцида до сублетальной концентрации (Johnston et al. 2002). Химические нейтрализаторы не использовались, так как отсутствуют данные об антимикробных тушителях для выбранных фитопрепаратов. Однако разбавление до сублетальных концентраций оказалось столь же эффективным, как и применение нейтрализаторов для БАС, ГТА, ОФК и ПАК с использованием методов, описанных Уолшем, Майлардом и Расселом (1999) и Фури и соавт. (2013). Прилипшие бактерии соскребали металлическим скальпелем с поверхности купонов и ресуспендировали в солевом растворе. Купоны также помещали в физиологический раствор и встряхивали (Heidolph reax-top, Schwabach, Германия) в течение 1 минуты, чтобы улучшить отделение бактерий и дезагрегировать кластеры клеток (Meireles et al. 2015). Жизнеспособность бактерий оценивали в чашках с агаром MH. Количество колониеобразующих единиц (КОЕ) оценивали через 24 ч инкубации при 30°С.Результаты представлены в виде log КОЕ на см 2 поверхности. Все опыты проводили в трехкратной повторности.

Статистический анализ

Данные анализировали с помощью статистической программы SPSS версии 20.0 (Statistical Package for the Social Sciences, SPSS, IBM Corporation, Нью-Йорк, США). Результаты были проанализированы с использованием теста One-Way ANOVA. Статистические расчеты были основаны на уровне достоверности ≥95% ( P <0,05 считалось статистически значимым).

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Использование дезинфицирующих средств в условиях больниц является первой линией защиты в профилактике инфекций и борьбе с ними. Недавние бактериальные вспышки подчеркнули важность профилактики инфекций и борьбы с ними, продемонстрировав, насколько быстро заболевание может распространяться как на национальном, так и на глобальном уровне (Duarte et al. 2009 г.; Gebel et al. 2013 г.). Растущее использование биоцидов также вызывает озабоченность в связи с появлением резистентности бактерий и усугублением токсичности для окружающей среды (SCENIHR 2009; Davin-Regli and Pages 2012).

Фитохимикаты являются привлекательным источником экологически безопасных, относительно недорогих и широко доступных новых противомикробных препаратов широкого спектра действия с низким уровнем кожной цитотоксичности, коррозии и токсичности для окружающей среды. Что касается антимикробного потенциала, фитохимические вещества уже продемонстрировали активность при использовании отдельно или в сочетании с другими соединениями в качестве антимикробных потенциаторов или агентов, изменяющих устойчивость менее эффективных продуктов (Saavedra et al. 2010; Abreu, McBain and Simões 2012).Тем не менее, устойчивость бактерий к фитохимическим веществам еще не изучена, вероятно, из-за их умеренного использования для контроля роста микробов (Simões, Bennett and Rose 2009; Abreu et al. 2013).

Три фитохимических продукта были выбраны для этого исследования на основании их различной химической структуры (CUM представляет собой бензальдегид с изопропиловой группой, EUG представляет собой фенилпропаноид и I3C представляет собой индол) и на основании предыдущих доказательств их противомикробной активности против планктонных бактерий ( Гилл и Холли, 2006 г.; Сунг и Ли, 2008 г.; Мандал и др. .2011). Гилл и Холли (2006) проверили способность некоторых соединений ароматических масел растений разрушать мембраны. Они оценили действие эвгенола против Escherichia coli , Listeria monocytogenes и Lactobacillus saki и обнаружили неспецифическое антимикробное действие этого соединения, по-видимому, из-за ингибирования АТФазы. Мандал и др. . (2011) протестировали антимикробную активность трех разных спиртовых экстрактов из трех разных растений.Они обнаружили антимикробное действие экстрактов тмина, содержащих ЦУМ, в отношении метициллин-резистентного штамма S. aureus (MRSA) с диапазоном МПК 128–512 мкг/мл. Sung and Lee (2008) оценили противомикробную активность I3C в отношении грамотрицательных ( штаммов E. coli и P. aeruginosa ) и грамположительных (штаммы S. aureus и E. faecium ) бактерий. MIC от 34 до 544 мкМ.

Передача патогенов через поверхности, загрязненные окружающей средой, зависит от их способности выживать в сухой среде. S. aureus способен выживать на сухих поверхностях в течение нескольких месяцев (Boyce et al. , 1997; Neely and Maley, 2000; Wagenvoort, Sluijsmans and Penders, 2000; Weinstein and Hota, 2004; Kramer, Schwebke and Kampf, 2006). В этом исследовании использовали четыре различных штамма S. aureus , три из которых экспрессировали характерные насосы оттока. Выражение оттока было признано основным фактором устойчивости к противомикробным препаратам и перекрестной устойчивости у бактерий (SCENHIR 2009).Эти штаммы подвергались воздействию природных и синтетических биоцидов. У BAC была самая низкая МИК, а у EUG была самая высокая МИК для всех протестированных штаммов (таблица 1). Среди синтетических биоцидов у GTA была самая высокая общая МИК (для всех испытанных штаммов). CUM, OPA и PAA показали аналогичные значения MIC ( P > 0,05). Однако OPA и CUM имели более низкую МИК по сравнению со штаммами CECT976 и SA1199b, в то время как ПАК имела более низкую МИК по сравнению со штаммами XU212 и RN4220. I3C показал значения MIC ниже, чем у дезинфицирующих средств высокого уровня (GTA, OPA и PAA) для всех штаммов ( P < 0.05). Значения MIC ясно показывают вариабельность чувствительности различных штаммов S. aureus : S. aureus , экспрессирующих эффлюксный насос, были менее чувствительны к фитохимическим веществам ( P <0,05). Это поведение также было проверено для BAC.

Таблица 1.

Минимальные ингибирующие концентрации (мг/л) природных и синтетических биоцидов (среднее ± стандартное отклонение трех независимых экспериментов). Приведены концентрации синтетических биоцидов при использовании (мг/л) для дезинфекции больниц (Rutala, Weber and Committee 2008; Al-Adhan, Haddabin and Collier 2013).БАК – хлорид бензалкония; ГТА — глутаровый альдегид; OPA— орто--фталевый альдегид; ПАА – надуксусная кислота; КУМ – куминовый альдегид; ЭУГ – эвгенол; I3C – индол-3-карбинол.

950 ± 41 950 ± 29 900 ± 44 900 ± 4000 ± 66 aureus xu212 900 ± 34
. БАК . ГТА . ОПА . ПАА . ОБЪЕМ . ЕСГ . I3C .
С.aureus CETT976 CECT976 1,5 ± 0,5 750 ± 41 620 ± 21 750 ± 29 612 ± 25 950 ± 43 156 ± 43
S. aureus RN4220 3.0 ± 0,8 750 ± 29 700 ± 44 600 ± 20 700 ± 41 300 ± 59
S. aureus SA1199B 4 ± 0,4 800 ± 58  500 ± 61  750 ±47  600 ± 43  1300 ± 82  400 ± 80 
3 ± 0,7 750 ± 20 700 ± 34 600 ± 42 700 ± 32 1200 ± 90 400 ± 65
в использовании концентрация 1000- 2000 20 000 5500 2000
900 900 ± 41 S. aureus xu212
. БАК . ГТА . ОПА . ПАА . ОБЪЕМ . ЕСГ . I3C .

S. aureus CECT976
1.5 ± 0.5 1,5 ± 0,5 750 ± 41 620 ± 21 750 ± 29 612 ± 25 950 ± 43 156 ± 43
S. aureus RN4220 3,0 ± 0.8 750 ± 29 750 ± 29 700897 700 ± 44 900 ± 44 600 ± 20 700 ± 41 1000 ± 66 300 ± 59
S. aureus SA1199B 4 ± 0,4 800 ± 58 500-697 500 ± 61 750 ± 47 750 ± 47 600 ± 43 1300 ± 82 400 ± 80
3 ± 0,7 750 ± 20 700 ± 34 600 ± 42 600 ± 42 700 ± 32 900 ± 32 1200 ± 90 400-6997 400 ± 65
в использовании концентрация 1000-2000 20 000 5500 – 
Таблица 1.

Минимальные ингибирующие концентрации (мг/л) природных и синтетических биоцидов (среднее ± стандартное отклонение трех независимых экспериментов). Приведены концентрации синтетических биоцидов при использовании (мг/л) для дезинфекции больниц (Rutala, Weber and Committee 2008; Al-Adhan, Haddabin and Collier 2013). БАК – хлорид бензалкония; ГТА — глутаровый альдегид; OPA— орто--фталевый альдегид; ПАА – надуксусная кислота; КУМ – куминовый альдегид; ЭУГ – эвгенол; I3C – индол-3-карбинол.

900

600 ± 20

950 ± 47 900 ± 34
. БАК . ГТА . ОПА . ПАА . ОБЪЕМ . ЕСГ . I3C .

S. aureus CECT976
1.5 ± 0.5 1,5 ± 0,5 750 ± 41 620 ± 21 750 ± 29 612 ± 25 950 ± 43 156 ± 43
С.aureus RN4220 3.0 ± 0,8 750 ± 29 700 ± 44 700 ± 41 1000 ± 66 300 ± 59
S. aureus SA1199B 4 ± 0,4 800 ± 58 800 ± 58 500 ± 61 750 ± 47 600 ± 43 1300 ± 82 400 ± 80
S. aureus xu212 3 ± 0,7 750 ± 20 700 ± 34 700 ± 34 600 ± 42 700 ± 32 1200 ± 90 400 ± 65
в использовании концентрация 1000-2000 20 000 5500 5500 2000
900

600 ± 20

950 ± 47 900 ± 34
. БАК . ГТА . ОПА . ПАА . ОБЪЕМ . ЕСГ . I3C .

S. aureus CECT976
1.5 ± 0.5 1,5 ± 0,5 750 ± 41 620 ± 21 750 ± 29 612 ± 25 950 ± 43 156 ± 43
С.aureus RN4220 3.0 ± 0,8 750 ± 29 700 ± 44 700 ± 41 1000 ± 66 300 ± 59
S. aureus SA1199B 4 ± 0,4 800 ± 58 800 ± 58 500 ± 61 750 ± 47 600 ± 43 1300 ± 82 400 ± 80
S. aureus xu212 3 ± 0,7 750 ± 20 700 ± 34 700 ± 34 600 ± 42 700 ± 32 1200 ± 90 400 ± 65
в использовании концентрация 1000-2000 20 000 5500 5500 2000

Степень повреждения мембраны, вызванная соединением, может быть связана с его гидрофобностью, которая может быть определена его коэффициентом распределения в октаноле/воде (L og P) (Nostro et al. 2007). Этот параметр был рассчитан для выбранных соединений как cLog P с использованием программного обеспечения ChemDraw Ultra 12.0 (Cambridge, UK). I3C имел самый низкий показатель cLog P (1,094), за ним следовали CUM (1,993) и EUG (2,397). В этом исследовании соединения на природной основе с более низким cLog P были соединениями с более низким MIC. Фактически, Kubo, Xiao и Fujita (2002) заметили, что липофильность соединений важна для антимикробного действия, даже если липофильность нельзя считать наиболее важным параметром для определения антимикробной активности соединений против MRSA.Фактически cLog P синтетических биоцидов (2,930 для БАС, 1,358 для ОФК, -0,924 для ПАК и -1,205 для ТГА) не позволяют установить их антимикробный потенциал.

Значения MIC использовались в качестве ориентира для выбора концентрации против прикрепленных бактерий на поверхностях. Биоциды использовались при MIC, 10 × MIC и 5500 мг/л, признавая, что биоцидная эффективность противомикробных препаратов против планктонных бактерий выше, чем против сидячих бактерий на поверхностях (Chavant, Gaillard-Martinie and Hébraud 2004). Значительная вариабельность адгезионной способности выбранного S.aureus ( P <0,05) (рис. 1). Эти прилипшие бактерии подвергались воздействию выбранных биоцидов в течение 30 минут. Как показано на рис. 1, при воздействии GTA, OPA и PAA бактерии не восстанавливались, независимо от концентрации биоцида, испытательной поверхности и используемого штамма. BAC при его MIC не был способен полностью устранить прикрепившиеся бактерии, за исключением штаммов CECT976 и SA1199b на SS. № S. aureus были извлечены с поверхности при нанесении 10 × MIC и 5500 мг/л на силикон и SS ( P > 0.05). BAC при MIC по сравнению с RN4220, прилипшим к силикону, не снижал количество КОЕ/см 2 . Тем не менее, MIC для BAC был примерно в 1000 раз ниже, чем используемая концентрация для дезинфекции в больницах (таблица 1) (Al-Adhan, Haddabin and Collier 2013). Эти результаты подтвердили, что антимикробные планктонные тесты не являются надежным предиктором действия БАС против прикрепившихся бактерий. Предыдущие исследования показали роль эффлюксных насосов в устойчивости к противомикробным препаратам, особенно к BAC (Huet et al. 2008 г.; Пейдждар, Сингх и Батиш, 2012 г.; Коста и др. 2013). Это вероятная причина того, что штаммы, несущие эффлюксные помпы, были менее восприимчивы к BAC на уровне MIC. Смит и Хантер (2008) также обнаружили, что BAC в концентрации 10000 мг/л не может полностью инактивировать биопленки, образованные MRSA и P. aeruginosa на поверхностях из нержавеющей стали, тефлона и полиэтилена. В настоящей работе BAC в концентрации 5500 мг/л был эффективен в удалении прилипших к монослою бактерий с поверхностей из нержавеющей стали и силикона.

Рис. 1.

Staphylococcus aureus , прилипший к силиконовым и нержавеющим поверхностям после 30 мин обработки природным (КУМ — куминальдегид; ЭУГ — эвгенол; И3К — индол-3-карбинол) и синтетическим (ВАЦ — бензалкония хлорид; ГТА — глутаральдегидом) ; ОФА — орто--фталевый альдегид; ПАА — надуксусная кислота) биоциды. Представлены средние значения ± стандартное отклонение по крайней мере для трех повторов. — необработанные образцы (контроль: ДМСО 10% об/об), ▪ — МИК, —10 × МИК, □ — 5500 мг/л. *— КОЕ не обнаружены, предел обнаружения: 2.8 Log КОЕ/см 2 .

Рис. 1.

Staphylococcus aureus , прикрепившийся к силикону и поверхностям из нержавеющей стали после 30-минутной обработки природным (ЦУМ — куминальдегид; ЭУГ — эвгенол; И3К — индол-3-карбинол) и синтетическим (ВАЦ — бензалконий) хлорид; ГТА — глутаровый альдегид; ОФА — орто--фталевый альдегид; ПАА — надуксусная кислота) биоциды. Представлены средние значения ± стандартное отклонение по крайней мере для трех повторов. — необработанные образцы (контроль: ДМСО 10% об/об), ▪ — МИК, —10 × МИК, □ — 5500 мг/л.*— КОЕ не обнаружены, предел обнаружения: 2,8 Log КОЕ/см 2 .

Что касается биоцидов на природной основе, то CUM и EUG продемонстрировали сходную эффективность в борьбе с монослойными бактериями, прикрепившимися к силикону. Никакие бактерии не были обнаружены после воздействия CUM при 10 × MIC и при 5500 мг/л для CECT976 и SA1199b на SS и при 5500 мг/л на SS для RN4220. Не было выживших бактерий для CECT976 и RN4220 на силиконовой поверхности с обработкой CUM при 10 × MIC. Менее 2 log КОЕ/см 2 снижения были получены с CUM при MIC по сравнению с CECT976, RN4220 и SA1199b, прилипшими к SS.Не наблюдалось значительного снижения после обработки CUM против XU212 на SS для всех протестированных концентраций ( P > 0,05). CUM во всех протестированных концентрациях не оказывал биоцидного действия на силикон в отношении SA1199b и при МИК и 10 × МИК в отношении XU212. Для других испытанных условий CUM производил <2 log КОЕ/см 2 . Антимикробная активность экстрактов Cuminum cyminum против планктонных клеток была продемонстрирована в другом месте (Shetty, Singhal and Kulkarni 1994).Наши результаты демонстрируют неадекватность CUM для борьбы с сидячими S. aureus при прилипании к силиконовым поверхностям. Возможное ограничение дезинфицирующей эффективности CUM может быть связано с его специфическим механизмом действия. Мандал и др. (2011) предположили, что экстракты C. cyminum могут влиять на синтез пептидогликанового слоя клеточной стенки, указывая на необходимость активного роста. Хотя экстракты C. cyminum могут быть многообещающей альтернативой и/или дополнением к химиотерапии антибиотиками, исследований, описывающих действие CUM на сидячие бактерии, не проводилось.

EUG — эфирное масло гвоздики, обычно используемое в качестве антисептика при инфекциях полости рта (Nuñez and D’Aquino 2012). Никакие бактерии (все штаммы) не были обнаружены после воздействия EUG при MIC, 10 × MIC и 5500 мг/л на SS. Однако при использовании EUG против SA1199b и XU212, прилипших к силикону, и при использовании EUG в MIC против RN4220 на силиконе снижения КОЕ не наблюдалось. Никакие бактерии не были обнаружены при обработке штамма CECT976 на силиконе EUG при 10 × MIC (около 9500 мг/л), что значительно выше, чем при использовании.EUG при 10 × MIC вызывал снижение >2,5 log КОЕ/см 2 по сравнению с RN4220 на силиконе. Другие обработки силикона вызывали снижение КОЕ <2,5 log КОЕ/см 2 . Gill and Holley (2006) продемонстрировали, что антимикробная активность EUG обусловлена ​​разрушением мембраны и неспецифической пермеабилизацией цитоплазматической мембраны, которые хорошо коррелируют с его cLog P (2,397). Это возможное неспецифическое действие EUG делает его интересным для применения в процессах дезинфекции, несмотря на его высокую МПК.Ядав и др. (2015) также продемонстрировали эффективность EUG для ингибирования и уничтожения биопленок клинических штаммов MRSA и MSSA. Эти авторы обнаружили, что EUG способен повреждать клеточную мембрану, нарушать межклеточные связи в биопленках, убивать S. aureus в биопленках и вмешиваться в экспрессию некоторых генов, связанных с биопленками, уменьшая накопление полисахаридов. и бактериальная адгезия (Yadav et al. 2015). Обычное использование EUG в зубной пасте в концентрациях от 100 до 100 000 мг/л (Banerjee et al. 2014), а также его эффективность при удалении биопленок in vitro и in vivo (Yadav et al. 2015) демонстрирует нетоксическое действие ЭУГ и его возможную эффективность при дезинфекции больниц даже против устойчивых к антибиотикам бактерий. .

I3C показал свою эффективность в снижении количества бактерий с обеих поверхностей, особенно при 10 × MIC и 5500 мг/л, при которых бактерии не были обнаружены. CECT976 не извлекались при применении I3C при МИК, 10 × МИК и 5500 мг/л на силиконе и SS.Точно так же не было восстановления бактерий на SS для RN4220 и силикона для SA1199b при 10 × MIC, 10 × MIC и 5500 мг/л против XU212 на силиконе и SS. Также не было достигнуто восстановления бактерий с SA199b на SS и с RN4220 на силиконе. Однако при использовании I3C при MIC против RN4220 и XU212 на силиконе снижения КОЕ не наблюдалось. Для остальных обработок наблюдалось снижение <2 log КОЕ/см 2 . I3C показал высокую эффективность (снижение общего количества КОЕ) для дезинфекции силикона и SS, загрязненных S.aureus , в том числе штаммы, экспрессирующие насосы оттока, при использовании концентраций ниже 5500 мг/л (значение, принятое в этом исследовании как концентрация, обычно применяемая в больницах, особенно OPA – Rutala, Weber and Committee (2008)). Lee, Cho and Lee (2011) заметили, что I3C в концентрации 100 мкг/мл способен снижать способность E. coli O157:H7 образовывать биопленки. Монте и др. (2014) также показали, что I3C способен инактивировать биопленки S. aureus и E.палочка . Это фитохимическое вещество также представляет потенциальный интерес для обращения вспять устойчивости к антибиотикам, поскольку предыдущее исследование продемонстрировало синергетический эффект комбинации I3C с различными антибиотиками (Sung and Lee 2008). В тех случаях, когда фитохимические вещества демонстрируют терапевтический потенциал в качестве эффективных модификаторов устойчивости к антибиотикам, маловероятно их использование в качестве больничных дезинфицирующих средств. Однако в настоящее время не существует терапевтической стратегии с использованием I3C в качестве модификаторов устойчивости к антибиотикам, а также отсутствуют предыдущие исследования роли I3C в качестве дезинфицирующего средства для поверхностей.

Наши данные по дезинфекции силиконом и нержавеющей сталью показали, что материал поверхности может существенно влиять на противомикробную эффективность биоцидов. Бактерии, прилипшие к силикону, оказались менее восприимчивы к действию биоцидов природного происхождения, чем прикрепившиеся к НС. Известно, что пористые поверхности могут обеспечить более высокую защиту от микроорганизмов (Rogers и др. 2005 г.; Grand и др. 2010 г.), и это может помочь объяснить результаты, полученные в этом исследовании с использованием силикона.I3C был единственным биоцидом на натуральной основе, способным полностью дезинфицировать силиконовые поверхности. Staphylococcus aureus CECT976, коллекционный штамм, оказался наиболее чувствительным к действию биоцидов природного происхождения. Общее снижение КОЕ с поверхностей СС наблюдалось для всех тестируемых соединений при 10 × МИК и 5500 мг/л, и даже при МИК для EUG и I3C. Кроме того, CUM, EUG и I3C не были эффективны для всех испытанных условий, оставаясь после обработки некоторыми жизнеспособными бактериями, особенно тех штаммов, которые экспрессируют насосы оттока и прилипают к силикону.Этот результат может быть связан с возможным механизмом резистентности. Тем не менее, необходимо провести специальные эксперименты, чтобы оценить предполагаемые механизмы устойчивости к фитохимическим веществам.

Наше исследование показало, что в применяемых условиях испытаний БАС, ТТА, ОФА и ПАК вызывали общее снижение количества КОЕ S. aureus , прилипших к силикону и SS. Использование соединений природного происхождения в концентрациях, близких к тем, которые используются для традиционных биоцидов, было эффективным при дезинфекции поверхностей СС, хотя их эффективность при более низких концентрациях была скромной.CUM и EUG продемонстрировали сходное поведение при дезинфекции силиконом. I3C был природным биоцидом с наиболее многообещающим дезинфицирующим потенциалом. Это исследование поддерживает использование биоцидов на природной основе в дезинфицирующих препаратах, помогая в разработке экологических стратегий противомикробных препаратов и способствуя потенциальной переработке старых биоцидов за счет комбинации активных молекул.

Авторы выражают благодарность профессору Саймону Гиббонсу (кафедра фармацевтической и биологической химии, Фармацевтическая школа, Фармацевтическая школа UCL, Лондон) за предоставленные бактериальные штаммы.

ФИНАНСИРОВАНИЕ

Эта работа финансировалась: Проектом UID/EQU/00511/2013-LEPABE, FCT/MEC с национальными средствами и софинансированием FEDER в рамках Соглашения о партнерстве P2020; Проект NORTE-07-0124-FEDER-000025 — RL2 Environment&Health, за счет средств FEDER через Programa Operacional Factores de Competitividade — COMPETE, за счет программы Programa Operacional do Norte (ON2) и за счет национальных фондов через FCT—Fundação para a Ciência ea Tecnologia/ MEC через Project Phytodisinfectants — PTDC/DTP-SAP/1078/2012.Работа была проведена в рамках мероприятий COST FA1202 и TD1305.

Конфликт интересов. Не объявлено.

ССЫЛКИ

Абреу

АС

Борхес

А

Сааведра

МДж

и другие.

Антибактериальная активность фенилизотиоцианата в отношении Escherichia coli и Staphylococcus aureus

Мед Химия

2012

12:

756

61

Абреу

АС

МакБейн

АДЖ

Симойнс

М

Растения как источники новых противомикробных препаратов и агентов, модифицирующих резистентность

Производственный отдел Nat

2012

29

1007

21

Абреу

АС

Таварес

руб.

Борхес

А

и другие.

Текущие и новые стратегии дезинфекции больничных помещений

J Антимикроб Chemoth

2013

68

2718

32

Акимицу

Н

Хамамото

Х

Иноуэ

Р-И

и другие.

Повышение устойчивости метициллин-резистентного штамма Staphylococcus aureus к бета-лактамам, вызванное мутациями, придающими устойчивость к бензалкония хлориду, дезинфицирующему средству, широко используемому в больницах

Антимикробные агенты Ch

1999

43

3042

3

Аль-Азан

я

Хаддабин

Р

Кольер

С.

Типы микробицидных и микробостатических агентов

Фрайз

АП

Майяр

JY.

Саттар

С.

Russell Hugo and Ayliffes: принципы и практика дезинфекции, профилактики и стерилизации

5-е изд.

Уайли-Блэквелл

Оксфорд, Великобритания

2013

Банерджи

Г

Бхонсле

К

Мадхаван

У

и другие.

Бьелданес

Л Ф

Ким

Дж И

Гроза

К Р

и другие.

Агонисты рецепторов реакции на ароматические углеводороды, полученные из индол-3-карбинола in vitro и in vivo : сравнение с 2,3,7,8-тетрахлордибензо-п-диоксином

P Национальная академия наук США

1991

88

9543

7

Бойс

ДжМ.

Загрязнение окружающей среды вносит важный вклад в больничную инфекцию

Джей Хосп Заражение

2007

65

Приложение 2

50

4

Бойс

ДжМ

Поттер-Байно

Г

Шеневерт

С

и другие.

Загрязнение окружающей среды из-за метициллин-резистентного штамма Staphylococcus aureus : возможные последствия инфекционного контроля

Infect Cont Hosp Ep

1997

18

622

7

Бридье

А

Брианде

Р

Томас

В

и другие.

Сравнительная биоцидная активность надуксусной кислоты, хлорида бензалкония и ортофталевого альдегида в отношении 77 штаммов бактерий

Джей Хосп Заражение

2011

78

208

13

Бридье

А

Санчес-Визуэте

МП

Ле Кок

Р

и другие.

Биопленки госпитального изолята Bacillus subtilis защищают Staphylococcus aureus от действия биоцида

PLoS Один

2012

7

е44506

Чаван

Р

Гайяр-Мартини

Б

Эбро

М

Антимикробное действие санитайзеров в отношении планктонных и сидячих Listeria monocytogenes клеток в зависимости от фазы роста

FEMS Microbiol Lett

2004

236

241

8

КЛСИ

Методы разбавления тестов на чувствительность к противомикробным препаратам для бактерий, которые растут аэробно; Утвержденный стандарт.Документ CLSI M07-A9

9-е изд.

Том. 32

Пенсильвания

Институт клинических и лабораторных стандартов

2012

Коста

нержавеющая сталь

Вивейрос

М

Амарал

л.

и другие.

Помпы для оттока нескольких препаратов в Staphylococcus aureus : обновление

Открытый микробиол J

2013

7

59

71

Давин-Регли

А

страницы

Дж

Перекрестная устойчивость между биоцидами и противомикробными препаратами: новый вопрос

Rev Sci Tech

2012

31

89

104

Дуарте

РС

Лоуренко

МКС

де Соуза Фонсека

ЛС

и другие.

Эпидемия послеоперационных инфекций, вызванных Mycobacterium massiliense

Дж Клин Микробиол

2009

47

2149

55

Фишер

CW

Фиорелло

А

Шаффер

Д

и другие.

Устойчивые к альдегиду микобактерии, связанные с использованием систем обработки эндоскопов

Am J Борьба с инфекциями

2012

40

880

2

Фури

л

Кьюза

мл

Рыцарь

Д

и другие.

Оценка сниженной чувствительности к соединениям четвертичного аммония и бисбигуанидам у клинических изолятов и лабораторных мутантов Staphylococcus aureus

Антимикробные агенты Ch

2013

57

3488

97

Гастмайер

Р

Вонберг

РП

Клебсиелла виды .при инфекциях, связанных с эндоскопией: возможно, мы видим только верхушку айсберга

Инфекция

2014

42

15

21

Гебель

Дж

Экснер

М

Французский

Г

и другие.

Роль дезинфекции поверхностей в профилактике инфекций

GMS Hyg Infect Control

2013

8

Док.10

Джилл

АО

Холли

РА

Разрушение клеточных мембран Escherichia coli, Listeria monocytogenes и Lactobacillus sayei ароматическими соединениями растительного масла

Int J Food Microbiol

2006

108

1

9

Гранд

я

Беллон-Фонтен

МН

Херри

ДжМ

и другие.

Устойчивость спор Bacillus atrophaeus к бактерицидному действию надуксусной кислоты зависит как от природы твердых субстратов, так и от способа заражения

J Appl Microbiol

2010

109

1706

14

Гриффитс

ПА

Бабб

ДЖР

Брэдли

CR

и другие.

Устойчивые к глутаральдегиду Mycobacterium chelonae из дезинфекторов для промывки эндоскопов

J Appl Microbiol

1997

82

519

26

Юэ

АА

Райгада

ДжЛ

Мендиратта

К

и другие.

Сверхэкспрессия мультилекарственного эффлюксного насоса у Staphylococcus aureus после однократного и многократного воздействия биоцидов и красителей in vitro

Микробиология

2008

154

3144

53

Ибускиса

ПС

Эррера

ДЖДЖР

Кабо

мл

Устойчивость к хлориду бензалкония, надуксусной кислоте и низину при образовании зрелых биопленок Listeria monocytogenes

Пищевой микробиол

2011

28

418

25

Джонстон

МД

Ламберт

РДВ

Хэнлон

ГВт

и другие.

Экспресс-метод оценки пригодности гасящих агентов для отдельных биоцидов, а также их комбинаций

J Appl Microbiol

2002

92

784

9

Просто

Дж

Бутон

ГЛ

Декан

БЖ

и другие.

Извлечение эвгенола из гвоздики с использованием немодифицированной бытовой эспрессо-машины: альтернатива традиционной паровой дистилляции

J Химическое образование

2016

93

213

6

Ковалева

Дж

Петерс

ФТМ

Ван дер Мей

ХК

и другие.

Передача инфекции при гибкой желудочно-кишечной эндоскопии и бронхоскопии

Клин Микробиол Ред.

2013

26

231

54

Крамер

А

Швебке

я

Кампф

Г

Как долго внутрибольничные патогены сохраняются на неодушевленных поверхностях? систематический обзор

BMC Infect Dis

2006

6

130

Кубо

я

Сяо

Р

Фуджита

Ки

Активность алкилгаллатов против MRSA

Bioorg Med Chem Lett

2002

12

113

6

Ли

JH

Чо

МЗ

Ли

Дж

3-Индолилацетонитрил снижает Escherichia coli O157:H7 образование биопленки и Pseudomonas aeruginosa вирулентность

Энвайрон Микробиол

2011

13

62

73

Лемос

М

Гомеш

я

Мергульян

Ф

и другие.

Влияние типа поверхности на удаление Bacillus cereus и Pseudomonas fluorescens биопленок одного и двух видов

Пищевой процесс Bioprod

2015

93

234

41

Майяр

ДЖ

Противомикробные биоциды в сфере здравоохранения: эффективность, использование, политика и предполагаемые проблемы

Ther Clin Risk Manag

2005

1

307

20

Мандал

С

ДебМандал

М

Саха

К

и другие.

In vitro антибактериальная активность трех индийских специй в отношении метициллин-резистентных штаммов Staphylococcus aureus

Оман Мед J

2011

26

319

23

Мейрелеш

А

Мачадо

я

Фульгенсио

Р

и другие.

Эффективность комбинаций противомикробных препаратов для снижения использования гипохлорита натрия для борьбы с планктонными и сидячими Escherichia coli

Биохим Eng J

2015

104

115

22

Монте

Дж

Абреу

А

Борхес

А

и другие.

Антимикробная активность отдельных фитохимических веществ в отношении Escherichia coli и Staphylococcus aureus и их биопленок

Патогены

2014

3

473

Моршеди

Д

Алиакбари

Ф

Таяранян-Марвиан

А

и другие.

Куминальдегид как основной компонент Cuminum cyminum , природный альдегид с ингибирующим действием на альфа-синуклеиновые фибрилляции и цитотоксичность

Дж. Пищевая наука

2015

80

х3336

45

Нили

АН

Малей

МП

Выживаемость Enterococci и Staphylococci на больничных тканях и пластике

Дж Клин Микробиол

2000

38

724

6

Ностро

А

Роккаро

КАК

Бизиньяно

Г

и другие.

Воздействие орегано, карвакрола и тимола на биопленки Staphylococcus aureus и Staphylococcus epidermidis

Дж Мед Микробиол

2007

56

519

23

Нуньес

л

Д’Акино

М

Микробицидная активность эфирного масла гвоздики (Eugenia caryophyllata)

Браз Дж Микробиол

2012

43

1255

60

Олуватуйи

М

Каатц

ГВт

Гиббонс

С

Антибактериальная и модифицирующая резистентность активность Rosmarinus officinalis

Фитохимия

2004

65:

3249

54

Выдра

ДЖА

Викери

К

Уокер

ДЖТ

и другие.

Клетки, прикрепленные к поверхностям, биопленки и чувствительность к биоцидам: значение для уборки и дезинфекции больниц

Джей Хосп Заражение

2015

89:

16

27

Пейдждар

А

Сингх

Дж

Батыш

ВК

Адаптация к бензалкония хлориду и ципрофлоксацину влияет на потенциал образования биопленки, насос оттока и активность гемолизина Escherichia coli молочного происхождения

J Молочная смесь

2012

79

383

9

Роджерс

СП

Сабурин

КЛК

Чой

ГВ

и другие.

Оценка дезактивации спор Bacillus anthracis, Bacillus subtilis и Geobacillus stearothermophilus на поверхностях помещений с использованием генератора перекиси водорода

J Appl Microbiol

2005

99

739

48

Рассел

г. н.э.

г.

Устойчивость бактерий к дезинфицирующим средствам: современные знания и будущие проблемы

J Hops Infect

1998

43

С57

68

Рассел

г. н.э.

г.

Суллер

МТЕ

Майяр

ДЖ

Отбираются ли антисептики и дезинфицирующие средства на устойчивость к антибиотикам?

Дж Мед Микробиол

1999

48

613

5

Рутала

ВА

Вебер

ДЖ

Комитет

HICPA

Руководство по дезинфекции и стерилизации в медицинских учреждениях

Северная Каролина

ЦКЗ

2008

Сааведра

МДж

Борхес

А

Диас

С

и другие.

Антимикробная активность продуктов гидролиза фенолов и глюкозинолатов и их синергизм со стрептомицином против патогенных бактерий

Мед Химия

2010

6

174

83

Сакагами

Д

Йокояма

Х

Нисимура

Х

и другие.

Механизм устойчивости к бензалкония хлориду штамма Pseudomonas aeruginosa

Appl Environ Microb

1989

55

2036

40

SCENIHR (Научный комитет по возникающим и недавно выявленным рискам для здоровья)

Оценка эффектов антибиотикорезистентности биоцидов

2009

Шетти

РС

Сингхал

РС

Кулкарни

ПР

Противомикробные свойства тмина

World J Microb Биот

1994

10

232

3

Симойнс

М

Перейра

МО

Мачадо

я

и другие.

Сравнительный антибактериальный потенциал отдельных биоцидов и поверхностно-активных веществ на основе альдегидов в отношении планктонных Pseudomonas fluorescens

J Ind Microbiol Biot

2006

33

741

9

Симойнс

ЛК

Симойнс

М

Оливейра

Р

и другие.

Возможность адгезии бактерий, выделенных из питьевой воды, к материалам

J Basic Microb

2007

47

174

83

Симойнс

М

Беннет

РН

Роза

ЕА

Понимание антимикробной активности фитохимических веществ против бактерий с множественной лекарственной устойчивостью и биопленок

Производственный отдел Nat

2009

26

746

57

Смит

Е

Уильямсон

М

Уэрхэм

Н

и другие.

Антибактериальные препараты и модуляторы бактериальной резистентности из неполовозрелых шишек Chamaecyparis lawsoniana

Фитохимия

2007

68

210

7

Смит

К

Охотник

ЕСТЬ

Эффективность обычных больничных биоцидов с биопленками клинических изолятов с множественной лекарственной устойчивостью

Дж Мед Микробиол

2008

57

966

73

Сун

ВС

Ли

ДГ

Механизм снижения чувствительности к грамотрицательным бактериям и синергический эффект с ампициллином индол-3-карбинола

Биол Фарм Бык

2008

31

1798

801

от

до

МС

Фаврин

С

Романова

Н

и другие.

Постадаптационная устойчивость к хлориду бензалкония и последующим физико-химическим модификациям Listeria monocytogenes

Appl Environ Microb

2002

68

5258

64

Вагенвоорт

ДХТ

Слуйсманс

Вт

Пендеры

РДЖР

Лучшее выживание в окружающей среде при вспышке по сравнению с другимиспорадические изоляты MRSA

Джей Хосп Заражение

2000

45

231

4

Уолш

СЭ

Майяр

иен

Рассел

г. н.э.

г.

Ортофталевый альдегид: возможная альтернатива глутаровому альдегиду для дезинфекции высокого уровня

J Appl Microbiol

1999

86

1039

46

Вебер

ДЖ

Рутала

ВА

Миллер

МБ

и другие.

Роль больничных поверхностей в передаче новых патогенов, связанных с оказанием медицинской помощи: Norovirus, Clostridium difficile и Acinetobacter видов

Am J Борьба с инфекциями

2010

38

С25

33

Вайнштейн

РА

Хота

Б

Заражение, дезинфекция и перекрестная колонизация. Являются ли поверхности больниц резервуарами внутрибольничной инфекции?

Клин Infect Dis

2004

39

1182

9

Ядав

МК

Че

SW

я

ГДж

и другие.

Эвгенол: фитосоединение, эффективное против метициллин-резистентных и метициллин-чувствительных Staphylococcus aureus клинических штаммов биопленок

PLoS Один

2015

10

е0119564

Дезинфицирующие средства с перекисью водорода и гипохлоритом натрия более эффективны против биопленок Staphylococcus aureus и Pseudomonas aeruginosa, чем соединения четвертичного аммония | Устойчивость к противомикробным препаратам и инфекционный контроль

  • Центр контроля заболеваний.Отчет о прогрессе инфекции, связанной с оказанием медицинской помощи. CDC. 2014 г. https://www.cdc.gov/hai/surveillance/progress-report/index.html. Опубликовано в 2016 г. По состоянию на 5 июля 2018 г.

  • Валлес Дж., Феррер Р. Инфекция кровотока в отделении интенсивной терапии. Заразить Dis Clin N Am. 2009; 23: 557–69.

    Артикул Google ученый

  • Камень PW. Экономическое бремя инфекций, связанных с оказанием медицинской помощи: точка зрения Америки. Эксперт Rev Pharmacoecon Outcomes Res.2009;9(5):417–22.

    ПабМед ПабМед Центральный Статья Google ученый

  • Джамал М., Ахмад В., Андлеб С., Джалил Ф., Имран М., Наваз М.А., Хуссейн Т., Али М., Рафик М., Камил М.А. Бактериальные биопленки и связанные с ними инфекции. J Chin Med Assoc. 2017;81(1):7–11.

    ПабМед Статья Google ученый

  • Викери К., Дева А., Джейкомбс А., Аллан Дж., Валенте П., Госбелл И.Б.Наличие биопленки, содержащей жизнеспособные полирезистентные организмы, несмотря на окончательную очистку клинических поверхностей в отделении интенсивной терапии. Джей Хосп заражает. 2012;80(1):52–5.

    КАС пабмед Статья Google ученый

  • Рутала WA, Weber DJ. Дезинфекция, стерилизация и контроль больничных отходов. В принципах и практике инфекционных заболеваний Манделла, Дугласа и Беннета. Том. 2. Elsevier Inc. 2014. с. 3294–3309.е1; https://doi.org/10.1016/B978-1-4557-4801-3.00301-5.

  • Куинн М.М., Хеннебергер П.К., Национальный институт безопасности и гигиены труда (NIOSH), Национальная программа исследований в области профессиональных исследований (NORA), рабочая группа по очистке и дезинфекции в здравоохранении, Браун Б., Делкло Г.Л., Фаган К., Хуанг В., Кнаак Дж.Л. , Кусек Л., Ли С.Дж., Ле Муаль Н., Махер К.А., С.Х. М.С., Митчелл А.Х., Печтер Э., Розенман К., Сехулстер Л., Стивенс А.С., Уилберн С., Зок Дж.П. Очистка и дезинфекция окружающих поверхностей в здравоохранении: на пути к интегрированной системе профилактики инфекций и профессиональных заболеваний.Am J Infect Control. 2015;43(5):424–34.

    ПабМед Статья Google ученый

  • Смит К., Хантер И.С. Эффективность обычных больничных биоцидов с биопленками клинических изолятов с множественной лекарственной устойчивостью. J Med Microbiol. 2008; 57: 966–73.

    КАС пабмед Статья Google ученый

  • Дантес Р., Мю Ю., Белфлауэр Р., Арагон Д., Думати Г., Харрисон Л.Х., Лесса Ф.К., Линфилд Р., Нэдл Дж., Пети С., Рэй С.М., Шаффнер В., Таунс Дж., Фридкин С.Программа новых инфекций – активное основное бактериальное наблюдение Исследователи эпиднадзора за MRSA. Национальное бремя инфекций, вызываемых инвазивным метициллин-резистентным золотистым стафилококком, США, 2011 г. JAMA Intern Med. 2013; 173:1970–8.

    ПабМед Google ученый

  • Liu J, Luo Z, Liu K, Zhang Y, Peng H, Hu B, Ren H, Zhou X, Qiu S, He X, Ye P, Bastani H, Lou L. Промывка при отслоении прикрепленных биопленок к стенкам металлических труб в водопроводных сетях.J Zhejiang Univ-Sci A. 2017; 18: 313–28.

    КАС Статья Google ученый

  • Крамер А., Швебке И., Кампф Г. Как долго внутрибольничные патогены сохраняются на неодушевленных поверхностях? Системный обзор. BMC Infect Dis. 2006; 6:130.

    ПабМед ПабМед Центральный Статья Google ученый

  • Персиваль С., Каттинг К., Томас Дж., Уильямс Д. Введение в мир микробиологии и биофильмологии.В: Персиваль С., Каттинг К., редакторы. Микробиология ран. Бока-Ратон: CRC Press; 2010.

    Глава Google ученый

  • Абдалла М., Хелисса О., Ибрагим А., Бенолиэль С., Хелиот Л., Далстер П., Чихиб Н.Э. Влияние температуры роста и типа поверхности на устойчивость биопленок Pseudomonas aeruginosa и Staphylococcus aureus к дезинфицирующим средствам. Int J Food Microbiol. 2015; 214:38–47.

    КАС пабмед Статья Google ученый

  • Бридье А., Брианде Р., Томас В., Дюбуа-Бриссонне Ф.Устойчивость бактериальных биопленок к дезинфицирующим средствам: обзор. Биообрастание. 2011;27:1017–32.

    КАС пабмед Статья Google ученый

  • Букингем-Мейер К., Герес Д.М., Гамильтон М.А. Сравнительная оценка испытаний эффективности биопленочных дезинфицирующих средств. J Микробиологические методы. 2007; 70: 236–44.

    КАС пабмед Статья Google ученый

  • Дэвисон В.М., Питтс Б., Стюарт П.С.Пространственные и временные закономерности действия биоцида на биопленки Staphylococcus epidermidis . Противомикробные агенты Chemother. 2010;54:2920–7.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Fagerlund A, Møretrø T, Heir E, Briandet R, Langsrud S. Очистка и дезинфекция биопленок, состоящих из Listeria monocytogenes и фоновой микробиоты с поверхностей мясопереработки. Appl Environ Microbiol.2017. https://doi.org/10.1128/AEM.01046-17.

  • Донлан РМ. Биопленки: микробная жизнь на поверхностях. Эмердж Инфекция Дис. 2002; 8: 881–90.

    ПабМед ПабМед Центральный Статья Google ученый

  • Мейер Б., Куксон Б. Создает ли микробная устойчивость или адаптация к биоцидам опасность для профилактики инфекций и борьбы с ними? Джей Хосп заражает. 2010;76:200–5.

    КАС пабмед Статья Google ученый

  • Агентство по охране окружающей среды.Методы и руководство по тестированию эффективности противомикробных препаратов против биопленок на твердых непористых поверхностях. АООС. 2017. https://www.epa.gov/pesticide-analytical-methods/methods-and-guidance-testing-efficacy-antimicrobial-products-against#efficacy-data. По состоянию на 2 ноября 2018 г.

  • Хонг Й, Теска П.Дж., Оливер Х.Ф. Влияние времени контакта и концентрации на бактерицидную эффективность 3 дезинфицирующих средств на твердых непористых поверхностях. Am J Infect Control. 2017. https://doi.org/10.1016/j.ajic.2017.04.015.

  • West AM, Teska PJ, Oliver HF. Зарегистрированные EPA дезинфицирующие салфетки не обладают дополнительной бактерицидной эффективностью после высыхания поверхности или по истечении времени контакта с этикеткой. Am J Infect Control. 2018;7:122. https://doi.org/10.1016/j.ajic.2018.07.005.

  • Ледвох К., Танцор С.Дж., Оттер Дж.А., Керр К., Ропост Д., Раштон Л., Вайзер Р., Махентиралингам Э., Мьюир Д.Д., Майллард Дж.Ю. Осторожно, биопленки! Сухие биопленки, содержащие бактериальные патогены, на нескольких медицинских поверхностях; многоцентровое исследование.Джей Хосп заражает. 2018;100:e47–56.

    КАС пабмед Статья Google ученый

  • Агентство по охране окружающей среды. Стандарты тестирования эффективности для данных о продукте требуют ответа. АООС; 2015 г. https://www.epa.gov/sites/production/files/2017-05/documents/reregistration_efficacy_standards.pdf. По состоянию на 1 августа 2018 г.

  • McBain AJ, Ledder RG, Moore LE, Catrenich CE, Gilbert P. Влияние составов на основе четвертичного аммония на динамику бактериального сообщества и чувствительность к противомикробным препаратам.Appl Environ Microbiol. 2004;70(6):3449–56.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Герба СР. Четвертичные аммониевые биоциды: эффективность применения. 2015. Appl Environ Microbiol. 2015;81(2):464–9.

    ПабМед ПабМед Центральный Статья Google ученый

  • Насиудис А., Джойс В.Ф., Ван Вельде Дж.В., Херен Р.МА., Ван ден Бринк О.Ф.Формирование малозарядных ионов синтетических полимеров с использованием соединений четвертичного аммония. Анальная хим. 2010;82:5735–42.

    КАС пабмед Статья Google ученый

  • Велпандиан Т., Джаябалан Н., Арора Б., Рави А.К., Котнала А. Понимание вопросов заряда в соединениях моно- и дичетвертичного аммония для их определения с помощью ЖХ/ЭСИ-МС/МС. Анальный латыш. 2012;45(16):2367–76.

    КАС Статья Google ученый

  • Ценг Б.С., Чжан В., Харрисон Дж.Дж., Квач Т.П., Сонг Дж.Л., Пентерман Дж., Сингх П.К., Чопп Д.Л., Пакман А.И., Парсек М.Р.Внеклеточный матрикс защищает биопленок Pseudomonas aeruginosa , ограничивая проникновение тобрамицина. Окружающая среда микробиол. 2013;15:2865–78.

    КАС пабмед ПабМед Центральный Google ученый

  • Тезел У, Спирос Г.П. Четвертичные аммиачные дезинфицирующие средства: микробная адаптация, деградация и экология. Энвайрон Биотех. 2015; 33:296–304 https://doi.org/10.1016/j.copbio.2015.03.018.

    КАС Google ученый

  • ДеКейрос Г.А., Дей Д.Ф.Антимикробная активность и эффективность комбинации гипохлорита натрия и перекиси водорода в уничтожении и удалении биопленок Pseudomonas aeruginosa с поверхностей. J Appl Microbiol. 2007 г. https://doi.org/10.1111/j.1365-2672.2007.03299.x.

  • Тивари С., Раджак С., Мондал Д.П., Бисвас Д. Гипохлорит натрия более эффективен, чем 70% этанол, против биопленок клинических изолятов Staphylococcus aureus . Am J Infect Control. 2018;46:e37–42.

    КАС пабмед Статья Google ученый

  • Барнс ТМ, Грейв К.А.Использование хлорных ванн для лечения инфицированной атопической экземы. Австралас Дж. Дерматол. 2013; 54: 251–8.

    ПабМед Статья Google ученый

  • Цинкарова Л., Полански О., Бабак В., Кулич П., Кралик П. Изменения экспрессии поверхностных белков, ассоциированных с биопленкой, в изолятах Staphylococcus aureus из пищевых продуктов и окружающей среды, подвергшихся воздействию сублетальных концентраций дезинфицирующих средств. Биомед Рез Инт. 2016. https://doi.org/10.1155/2016/4034517.

  • Boyce MJ, Guercia KA, Sullivan L, Havill NL, Fekieta R, Kozakiewicz J, Goffman D. Проспективное кластерное контролируемое перекрестное исследование для сравнения воздействия улучшенного дезинфицирующего средства на основе перекиси водорода и дезинфицирующего средства на основе четвертичного аммония на загрязнение поверхности и результаты здравоохранения. Am J Infect Control. 2017;45:1006–10.

    КАС пабмед Статья Google ученый

  • Омидбахш Н.Новое совместимое с гибкими эндоскопами дезинфицирующее средство высокого уровня на основе пероксида. Am J Infect Control. 2006; 34:571.

    ПабМед Статья Google ученый

  • Рутала WA, Weber DJ. Дезинфекция эндоскопов: обзор новых химических стерилизаторов, используемых для дезинфекции высокого уровня. Infect Control Hosp Epidemiol. 1999;20:69.

    КАС пабмед Статья Google ученый

  • Альфа М.Дж., Джексон М.Новое моющее средство для медицинского оборудования на основе перекиси водорода с бактерицидными свойствами: сравнение с ферментными чистящими средствами. Am J Infect Control. 2001; 29:168.

    КАС пабмед Статья Google ученый

  • Митчелл К.Ф., Зарновски Р., Санчес Х., Эдвард Дж.А., Рейнике Э.Л., Нетт Дж.Е., Митчелл А.П., Анды Д.Р. Участие сообщества в сборке и функционировании матрицы биопленки. Proc Natl Acad Sci U S A. 2015;112:4092–7.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Аль-Джайлави М., Амин Р., Аль-Джебури М.Р.Влияние дезинфицирующих средств на чувствительность к антибиотикам Pseudomonas aeruginosa . J Appl Biotechnol. 2013. https://doi.org/10.5296/jab.v1i1.4038.

  • Гилберт П., Дас Дж. Р., Джонс М. В., Эллисон Д. Г. Оценка устойчивости к биоцидам после прикрепления микроорганизмов к поверхностям и роста на них. J Appl Microbiol. 2001; 91: 248–54.

    КАС пабмед Статья Google ученый

  • Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка браузера на прием файлов cookie

    Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
    • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

    Разница между дезинфицирующими средствами и антисептиками: Фармацевтические рекомендации

    Дезинфицирующие и антисептические средства широко используются для уборки как в медицинских учреждениях, так и в домашних условиях.Эти продукты содержат различные химические компоненты, большинство из которых веками использовались в качестве чистящих средств. Это факт, что они оба используются для уничтожения болезнетворных микроорганизмов, что может заставить людей думать, что это одно и то же. Но правда в том, что они очень разные во многих отношениях, особенно в том, как они применяются.

    Что такое дезинфицирующие средства?

    Дезинфицирующие средства представляют собой химические вещества, которые можно наносить на неживые объекты или поверхности для подавления роста микроорганизмов.Они предотвращают распространение микробов и бактерий среди людей, стерилизуя поверхности, на которые они наносятся. Дезинфицирующие средства в основном используются в домах для мытья ванных комнат, кухонь и полов. Некоторые дезинфицирующие средства, такие как перекись водорода, используются в медицинских учреждениях и больницах для очистки хирургических инструментов и помещений. Наиболее распространенными дезинфицирующими средствами являются спирты, окислители и отбеливатели.

    Важно отметить, что дезинфицирующие средства не обязательно уничтожают все микроорганизмы. Некоторые микроорганизмы могут быть устойчивыми к некоторым дезинфицирующим средствам, что затрудняет их полное уничтожение.Таким образом, дезинфицирующие средства могут только уменьшить количество микроорганизмов до уровня, при котором они не могут нанести вред здоровью или ухудшить качество скоропортящихся продуктов. В таких случаях лучше всего использовать дезинфицирующие средства более высокой концентрации для достижения максимальных результатов.
    Связанный: Различные типы дезинфицирующих средств для рук, используемые в фармацевтике

    Что такое Антисептики?

    Антисептики — это химические вещества, используемые для уничтожения или предотвращения роста микроорганизмов, которые могут вызывать инфекции или заболевания. Их наносят на поврежденную кожу, чтобы убить болезнетворные микроорганизмы, которые могли заразить эти участки, или держать их подальше от этих участков.Таким образом, антисептические растворы

    предназначены для нанесения на живые ткани с нулевым повреждающим действием на поверхность тела, на которую они наносятся. Антисептики могут также действовать как дезинфицирующие средства для мытья рук, чтобы удалить бактерии, когда человек не может вымыть руки. Они популярны в таких продуктах, как жидкость для полоскания рта, герпес, лечебные кремы и т. д., и этот список можно продолжать долго.

    Основные отличия

    1. Дезинфицирующие средства наносятся на неживые предметы, а растворы антисептиков наносятся на живые ткани.Оба они предотвращают распространение и заражение людей болезнетворными микроорганизмами.
    2. Дезинфицирующие средства подавляют рост микроорганизмов, существующих на поверхностях, на которые они наносятся, в то время как антисептики убивают и разрушают микроорганизмы на живых тканях.
    3. Дезинфицирующие средства дезинфицируют участки, которые могут распространять микробы, а антисептические растворы снижают риск заражения микробами.
    4. Дезинфицирующие средства очень токсичны и повреждают живые ткани, в то время как антисептики не оказывают повреждающего действия на живые ткани.
    Связано: Принцип действия дезинфицирующих растворов

    Учитывая упомянутые выше различия между дезинфицирующими средствами и антисептиками, становится ясно, что их основное различие заключается в их применении. Многие люди часто взаимозаменяемо применяли один вместо другого, не зная, что они используются по-разному. Это объяснило бы, почему некоторые люди не могут контролировать микробы или все еще заболевают бактериальными инфекциями, несмотря на постоянное использование противомикробных препаратов. Проблема в том, как они используют агентов.Важно отметить, что применение дезинфицирующих и антисептических средств совершенно различно.

    Введение в дезинфицирующие средства — Лаборатория Microchem

    Определение. Дезинфицирующие и дезинфицирующие средства — это химические вещества, используемые для быстрой инактивации микроорганизмов на неодушевленных поверхностях. Вообще говоря, дезинфицирующие средства более эффективны, чем дезинфицирующие средства.

    На этой странице представлен широкий обзор дезинфицирующих и дезинфицирующих средств. В дополнение к информации, представленной ниже, вас могут заинтересовать следующие темы:

    Прежде чем мы начнем, давайте рассмотрим разницу между дезинфицирующими средствами и антибиотиками: Дезинфицирующие средства отличаются от антибиотиков, хотя оба они убивают микробы и оба считаются противомикробными. .Вообще говоря, дезинфицирующие средства уничтожают многие компоненты микроорганизмов одновременно и небезопасны для приема внутрь или инъекций. Антибиотики, с другой стороны, обычно разрушают одну или несколько частей микроорганизмов и относительно малотоксичны для организма.

    Большинство дезинфицирующих средств состоят из различных ингредиентов, включая воду, поверхностно-активные вещества (детергенты) и ароматизаторы. Эти полные, стабильные при хранении растворы называются препаратами. Многие дезинфицирующие средства также являются отличными чистящими средствами (щелкните здесь, чтобы получить больше информации о чистящих средствах).В рецептуре химическое вещество, убивающее микроорганизмы, называется активным ингредиентом.

    Некоторые общие активные ингредиенты перечислены ниже вместе с основными преимуществами и недостатками:

    Когда дезинфицирующие средства используются для уничтожения микроорганизмов на теле, их называют антисептиками. Когда активные ингредиенты используются на руках, их называют дезинфицирующим средством для рук. Несколько сильнодействующих активных ингредиентов также можно использовать в высоких концентрациях для стерилизации медицинского оборудования, такого как хирургические эндоскопы, без нагревания.Составы, которые стерилизуют медицинское оборудование, называются холодными стерилизаторами.

    Дезинфицирующие средства и дезинфицирующие средства для неодушевленных поверхностей регулируются Агентством по охране окружающей среды США как пестициды (Агентство по охране окружающей среды считает бактерии, вирусы, паразиты и грибки вредителями, поэтому они подпадают под действие Федерального закона об инсектицидах, фунгицидах и родентицидах). EPA требует, чтобы дезинфицирующие средства, продаваемые в Соединенных Штатах, были тщательно охарактеризованы с точки зрения их безопасности и эффективности и соответствовали конкретным инструкциям по маркировке, прежде чем они поступят на рынок.

    Этикетки на дезинфицирующих средствах в США содержат большой объем информации, и вся эта информация должна быть одобрена Агентством по охране окружающей среды. Нажмите на бутылку, чтобы изучить этикетку дезинфицирующего средства в США.

    Эти методы испытаний обычно используются Агентством по охране окружающей среды для оценки антимикробной эффективности дезинфицирующих средств и формулирования заявлений, связанных с микробами: риски, которые дезинфицирующие средства будут представлять для человека, и установить предупреждения на этикетках.Некоторые из этих тестов болезненны. Лаборатория Microchem не проводит испытания на животных и не поддерживает их использование в качестве средства для характеристики рисков, связанных с дезинфицирующими средствами.

    Спасибо за изучение дезинфицирующих средств в лаборатории Microchem!

    Заходите в ближайшее время для получения дополнительной информации и обновлений! Этот материал предназначен только для образовательных целей.

    В чем разница между очисткой и дезинфекцией?

    Неважно, обслуживаете ли вы школу, больницу, офис или любое другое учреждение — очистка и дезинфекция являются важной частью вашего обслуживания.Содержание вашего учреждения в чистоте уменьшит распространение болезней и улучшит общий вид вашего учреждения.

    Очистка и дезинфекция — лучший способ уменьшить распространение микробов по твердым поверхностям в вашем учреждении.

    Не уверены, следует ли вам использовать чистящее или дезинфицирующее средство в вашем учреждении? Если вы проводите дезинфекцию, вы должны использовать оба.

    Pro Совет: можно очистить без дезинфекции, но нельзя дезинфицировать без очистки.Если вы занимаетесь уборкой и вам не нужно убивать и удалять микробы, то и дезинфицировать не нужно. Если вы хотите убить микробы на поверхности, вам необходимо продезинфицировать ее после очистки.

     

     

    Очистка и дезинфекция — это две разные процедуры, которые следует использовать вместе для удаления и уничтожения микробов.

    Всегда очищайте перед дезинфекцией

    Важно очистить или удалить все видимые загрязнения перед дезинфекцией.Очистка удаляет рыхлые загрязнения, подготавливая поверхность или объект для дезинфекции.

    Дезинфекция убивает микробов на поверхности, предотвращая их распространение. Если поверхность предварительно не очистить, микробов могут спрятаться под почвой и снизить эффективность дезинфицирующего средства.

    Какие области следует дезинфицировать?

    В зависимости от вашего объекта и отрасли, разные зоны в вашем здании будут иметь разные протоколы относительно того, следует ли их очищать или очищать и дезинфицировать.Проконсультируйтесь со своим руководителем относительно надлежащих процедур очистки и дезинфекции.

    Места частого контакта всегда следует дезинфицировать. В зависимости от поверхности и помещения вам, возможно, придется дезинфицировать поверхности, к которым часто прикасаются, несколько раз в день.

    Области частого касания включают:

    • Дверные ручки
    • Поручни
    • Выключатели света
    • Дозатор для мыла
    • Ручки стула

    Что такое уборка?

    Очистка — это процесс физического удаления микробов, грязи и других загрязнений с поверхностей.

    Для очистки поверхности используйте универсальное чистящее средство и салфетку из микрофибры или махровую тряпку, чтобы удалить загрязнения.

    Насколько эффективны чистящие средства?

    Чистящие средства в сочетании с надлежащей процедурой очистки удаляют почти все микробы и загрязнения с поверхности.

    Если вы используете чистящее средство для уничтожения вредных микробов, на самом деле вы ничего не уничтожили.

    Очистка удаляет только микробы и грязь с поверхности.Это их не убивает . Микробы, которые не были удалены, будут продолжать размножаться и распространяться.

    Факт: Большинство бактерий размножаются путем деления на две части. В правильных условиях бактерии, такие как кишечная палочка, более известная как кишечная палочка, могут делиться каждые 20 минут. Это означает, что за 7 часов одна бактерия произвела более 2 097 152 микробов.

    Чтобы убить организмов, оставшихся после очистки, необходимо нанести на поверхность дезинфицирующее средство.

    Что такое дезинфекция?

    Дезинфекция убивает микробы.

    Дезинфицирующие средства не удаляют загрязнения с поверхностей .

    Дезинфицирующие средства необходимо использовать после чистящих средств, так как они не могут проникнуть через загрязнения на поверхности.

    Совет для профессионалов. Если вы используете дезинфицирующее средство для очистки загрязнений, например разлитой соды или остатков пищи, вы не эффективно удаляете загрязнения.

    После высыхания дезинфицирующего средства после высыхания дезинфицирующего средства у вас останется липкая и вонючая поверхность.

    Для уничтожения микробов большинство дезинфицирующих средств содержат хлорид четвертичного аммония (QUATS), пероксид (на основе перекиси водорода) или гипохлорит (на основе отбеливателя).

    Каждый тип дезинфицирующего средства имеет свои преимущества и недостатки.

    Насколько эффективны дезинфицирующие средства?

    Дезинфицирующие средства убивают 100% микробов , перечисленных в данных производителя, при правильном использовании.

    Совет для профессионалов. Коммерческие чистящие средства должны быть зарегистрированы Агентством по охране окружающей среды (EPA).

    Коммерческий чистящий раствор не может классифицироваться как дезинфицирующее средство, если только он не прошел испытания Агентства по охране окружающей среды и не доказал, что он убивает 100% микробов (указанных на его этикетке) с данной поверхности.

    Чтобы дезинфицирующее средство было эффективным, оно должно находиться в течение рекомендованного времени пребывания.

    Среднее время действия дезинфицирующего средства зависит от типа дезинфицирующего средства и микроорганизмов, которые вы пытаетесь уничтожить. Больницам, скорее всего, потребуется дезинфицирующее средство более высокого (больничного) класса.

    Дезинфицирующие средства, которые не остаются влажными в течение рекомендуемого времени выдержки, не убивают столько микробов и считаются неэффективными.

    Совет для профессионалов: что такое время ожидания?

    Время выдержки — это время, в течение которого дезинфицирующее средство должно оставаться влажным на поверхности для эффективной дезинфекции (уничтожения организмов, перечисленных на этикетке) поверхности.

    Различные коммерческие чистящие средства требуют разного времени выдержки в зависимости от регистрации EPA и времени контакта, необходимого для каждого организма.Коммерческие чистящие средства, которые не используются с надлежащим временем выдержки и процессом удаления, не обеспечивают эффективную дезинфекцию и не соответствуют требованиям Агентства по охране окружающей среды.

    Обратитесь к данным производителя вашего химиката, чтобы узнать надлежащее время выдержки для каждого типа организма.

    Поверхности, которые не продезинфицированы должным образом, повышают вероятность распространения микробов и возникновения заболеваний в вашем учреждении.

    Если вы пропустите хотя бы дюйм поверхности или не оставите дезинфицирующее средство на необходимое время, вы позволите микробам размножаться и продолжать распространяться.

    Загрузите нашу БЕСПЛАТНУЮ книгу  План готовности к коронавирусу: 6 жизненно важных шагов для защиты вашего объекта,   , предназначенную для предоставления вам 6 жизненно важных шагов, необходимых для защиты вашего объекта от вспышки коронавируса.

     

    Дезинфекцию можно проводить в один или два этапа.

    Одноэтапный процесс

    В одноэтапном процессе дезинфекции очистка и дезинфекция выполняются одновременно с продуктом, помеченным как чистящее/дезинфицирующее средство или дезинфицирующее/чистящее средство.

    Чистящие/дезинфицирующие средства удаляют и убивают микробы одновременно.

    Убедитесь, что чистящее/дезинфицирующее средство выдерживается в течение рекомендуемого времени. Надлежащее время выдержки имеет решающее значение для обеспечения уничтожения всех   организмов (перечисленных на этикетке продукта) на поверхности.

    Совет: иногда использование комбинированных чистящих/дезинфицирующих средств не так эффективно, как двухэтапный метод.

    Чистящие/дезинфицирующие средства не могут должным образом удалять более тяжелые загрязнения, что необходимо для полного уничтожения дезинфицирующим средством всех (помеченных) организмов на поверхности.

    Двухэтапный процесс

    В двухэтапном процессе дезинфекции поверхность очищается и дезинфицируется с использованием двух разных продуктов.

    Сначала наносится чистящее средство для удаления видимых и рыхлых загрязнений с поверхности или предмета.

    Используйте салфетку из микрофибры, чтобы нанести дезинфицирующее средство на поверхность.

    Выберите цвет ткани для каждой поверхности в вашем помещении, чтобы избежать возможного перекрестного загрязнения.

    Во-вторых, на поверхность или объект наносится дезинфицирующее средство.

    Убедитесь, что дезинфицирующее средство остается влажным на поверхности в течение рекомендуемого времени выдержки.

    Время ожидания, перечисленные заявления об уничтожении и процесс удаления определят, насколько эффективна ваша процедура дезинфекции. Если вы не соблюдаете рекомендуемое производителем время выдержки для помеченных организмов, продукт не достигнет заявленной эффективности.

    Сокращение количества микробов, которые на самом деле убивает ваш продукт, позволит микробам размножаться и продолжать распространяться по всему вашему учреждению.


    Заключительные мысли

    Хотя сокращение числа микробов важно на любом объекте, для разных объектов потребуются разные чистящие средства и процедуры в зависимости от частоты, поверхностей и требований к очистке и ожиданий бизнеса.

    Свяжитесь со специалистом EBP сегодня, чтобы он проверил ваши текущие чистящие средства и процедуры, чтобы помочь вам выявить любые пробелы в ваших процедурах очистки и дезинфекции.

    Если вы находитесь в США, Пуэрто-Рико или на Карибах, EBP и другие центры Imperial Dade могут помочь вам разработать эффективную программу очистки и порекомендовать лучшие продукты, процессы и обучение для вашего предприятия и бюджета.

    Загрузите нашу БЕСПЛАТНУЮ книгу  План готовности к коронавирусу: 6 жизненно важных шагов для защиты вашего объекта,   , предназначенную для предоставления вам 6 жизненно важных шагов, необходимых для защиты вашего объекта от вспышки коронавируса.

    Posted in Разное

    Добавить комментарий

    Ваш адрес email не будет опубликован.