Для чего нужен праймер: зачем нужен и как пользоваться

Для чего нужен праймер: зачем нужен и как пользоваться

30.12.1989

Содержание

Зачем нужен праймер в макияже и как им пользоваться

Его нужно наносить после ухода за кожей.

Профессиональные визажисты никогда не наносят косметику на просто очищенную кожу. Они ее тонизируют, увлажняют, а потом пользуются праймером. Кроме того, праймеры существуют не только для кожи, но и для век, губ и даже ресниц.

Эксперты рассказали, что сегодня праймер — это базовый продукт, который должен быть в каждой косметичке. Он выполняет функцию базы, основы под макияж, с ним остальные средства работают и фиксируются лучше.

«Праймер для лица увлажняет, смягчает, выравнивает тон и текстуру кожи, нивелируя ее несовершенства, а иногда даже оказывает лифтинг-эффект. Похожими свойствами обладают праймеры для век и губ», — рассказал визажист Захар Гринов.

Он добавил, что праймеры для губ и теней усиливают оттенки, а праймер для ресниц — разделяет и удлиняет их, не дает туши осыпаться.

Кремовые праймеры быстро впитываются, увлажняют и освежают кожу, силиконовые – сужают поры и выравнивают дерму. Праймеры на водной основе подходят сухой коже, поскольку деликатно увлажняют ее и не создают ощущения жирности.

Существуют также и масляные праймеры, их делают на основе легких масел, которые быстро впитываются. Визажисты рекомендуют наносить их на сухую или возрастную кожу, причем одной капли должно хватить на все лицо.

Праймеры для ресниц обычно белого или прозрачного цвета. Прежде чем нанести тушь, необходимо убедиться, что праймер полностью высок, и уже поверх него красить ресницы.

Визажисты советуют наносить праймеры для кожи пальцами. Так кисть или спонж не впитает его, а параллельно руками можно сделать и легкий массаж лица, пишет InStyle.

Если кожа здоровая и не требует плотного слоя тона и консилера, можно остановиться на праймере, закрепив его рассыпчатой пудрой бежевого цвета — макияж получится по-настоящему вуальным и свежим.

Напомним, звезда сериала «Игра в кальмара» показала, как она наносит свой простой ежедневный макияж.

Для чего нужен праймер? Кислотные и бескислотные праймеры для ногтей

Для того, чтобы Ваш маникюр, а также маникюр Ваших любимых клиентов хорошо носился и не появлялось сколов Вам обязательно понадобится праймер для ногтей – это средство, которое кажется невидимым и незначительным, но на самом деле играет одну из важных ролей, которая влияет на носку Ваших красивых ноготков.

Мы с радостью хотим поделиться с Вами советами о том, как правильно подобрать праймер для разных типов ногтевой пластины и расскажем Вам о том, почему он таким образом влияет на носку маникюра!


Давайте разберём с Вами самый важный вопрос! Знакомство с праймером для ногтей!

Праймер — это специальное средство, которое усиливает адгезию при подготовке Ваших ногтей к последующему искусственному покрытию.

Самые главные функции, которые выполняет этот чудодейственный материал:

  1. Избавляет ногтевую пластину от излишней влаги
  2. Обезжиривает ногтевую пластину
  3. Служит двусторонним скотчем для сцепки натурального ногтя с искусственными материалами

Один из важных плюсов праймера выражается в том, что он не создаёт дополнительный слой покрытия и его жидкая, лёгкая текстура. Второй важный плюс праймера, то что он сохнет на воздухе в течении 30-60 секунд и не требует сушки в лампе. Ну и самый главный плюс – праймер дарит Вашему покрытию прочность, а также помогает любому искусственному материалу хорошо взаимодействовать с ногтевой пластиной.

Какие бывают праймеры и в чём их отличия?


Праймеры делятся на два вида: кислотные и бескислотные.

Давайте немножко поговорим о том, какая между ними разница?

Бескислотные праймеры

Бескислотный праймер создаёт на ноготке очень липкий слой, благодаря которому сцепка материала и ногтевой пластины улучшается и материал держится гораздо лучше.

Бескислотный праймер не дезинфицирует и не обезжиривает ногтевую пластину, так как он более щадящий в отличие от кислотного, поэтому если Вы используете бескислотный праймер Вам нужно использовать его в комплексе с другими жидкостями — обезжиривателями, дезинфекторами, дегидратороми.

Важно:

Праймер наносится только на свободный край ногтевой пластины тонким слоем. На весь ноготь праймер наносить не нужно, так как могут пойти отслойки. Данный вид праймера не содержит кислот, он является более щадящим для ногтевой пластины и не нарушает её баланс.

Кислотные праймеры для ногтевой пластины

Кислотный праймер содержит метакриловую кислоту. Данная кислота на ногтевой пластине образует чешуйки за которые в последующем цепляется искусственный материал. Такой праймер идеально подходит как очень влажным, так и очень жирным ногтям.

Кислотный праймер используют для проблемной ногтевой пластины, либо пластины с гипергидрозом, а также при наращивании.

Чтобы избежать ожогов, аллергии и истончения ногтей используйте пожалуйста кислотный праймер правильно, также если вдруг клиент почувствовал жжениене медленно смойте водой участок, на который нанесли праймер, чтобы не допустить ожога. Не наносите более чем 2 слоя кислотного праймера.

Кислота, которая содержится в праймере имеет очень резкий и неприятный запах. Поэтому мы рекомендуем работать с данным праймером в средствах индивидуальной защиты.

У кислотного праймера есть очень важные преимущества – благодаря своим бактерицидным свойствам он блокирует развитие микробов между ногтевой пластиной и покрытием.

Праймер и бондер в чём разница?

На данный момент производители Nail-индустрии выпускают очень много средств под разными названиями, для того чтобы не ошибиться и купить именно праймер всегда на баночке ищете такие надписи как «кислотный» либо «бескислотный», также может быть написано «non acid».

Как нанести на ноготок праймер, чтобы не навредить?

Праймер наносится на свободный край ногтя.

Сперва мы определяемся какой праймер нам нужен, в зависимости от ногтей: кислотный либо бескислотный. После нанесения праймера сушим его 1 минуту.

Спасибо за внимание! С теплом и добром, Ваш Nails Time!

Что такое праймер для ногтей и для чего он нужен?

Мастера маникюрных салонов используют современные средства для подготовки ногтей к нанесению покрытия. Одно из них – это праймер (с англ. prime — грунтовка), который позволяет защитить ноготь и увеличить стойкость маникюра, а соответственно – он продержится намного дольше.



Содержание:

Что такое праймер

Праймер – это специальное средство для ногтей, предназначенное для обезжиривания, очищения поверхности, недопущения отслоек покрытия. Он улучшает сцепление ногтевой пластины с ногтем, удаляет частички подкожного жира, защищает ноготь от развития патогенных микроорганизмов.

Для чего нужен праймер

Оно быстро высыхает на воздухе в течение 30-60 секунд, поэтому использование лампы для маникюра не требуется.

Характеристики грунтовки отличаются, зависят от его состава и назначения. Но в целом основные характеристики и назначения одинаковые у разных ее видов:

  • Обеспечивает защиту натурального ногтя от грибковой инфекции и других патогенных микроорганизмов, защищает от отслойки и появления желтого налета.
  • Исключает появление парникового эффекта между естественным ногтем и искусственной ногтевой пластиной, препятствует развитию вредных микроорганизмов.
  • Обеспечивает надежное склеивание ногтевой пластины с поверхностью натурального ногтя, что увеличивает долговечность маникюра.
  • Качественно обезжиривает и подсушивает поверхность.

Состав и внешний вид

Праймер представляет собой бесцветную жидкость. Внешне он напоминает воду, но имеет специфический запах. Состав разных видов данного средства мало чем отличаются. Содержание веществ могут незначительно меняться, в зависимости от его вида, производителя. В их состав может входить метакриловая кислота, бутилметакрилат, этанол, бутилацетат, этилацетат, бутилацетат, изопропил.

Что такое праймер

Праймеры делятся на две группы:

  • Кислотные – содержат метакриловую кислоту, которая обеспечивает хорошую адгезию покрытия с поверхностью ногтя. Кислотный состав используется во время процедуры наращивания, чтобы приблизить pH натурального ногтя к уровню наращенного. После нанесения на ногтевую пластину приподнимает её чешуйки. Образовавшиеся полости позже заполняются гелем и после полимеризации становятся единым целым с ногтем.

Важно! Метакриловая кислота, входящая в состав этого продукта — очень агрессивное вещество, которое может спровоцировать появление ожогов, поэтому работать с таким праймером нужно аккуратно! Наносите его тонким слоем, отступая от боковых пазух и кутикулы.


  • Бескислотные – оставляют на ногтевой пластине липкий слой, за счет которого продукт гарантирует надежную сцепку материалов. В его состав включены компоненты, которые временно меняют рН ногтя, чтобы он стал максимально близок к рН наносимого материала. Через несколько минут pH приходит в норму. Такие жидкости не походят для акрилового наращивания, а применяются при гелевом. Этот вид праймера не оказывает дезинфицирующего действия и не убирает лишнюю влагу, поэтому в некоторых случаях его лучше использовать в комплексе с другими продуктами — обезжиривателем, дезинфектором, дегидратором.

Что такое праймер

При выборе грунтовки учитывается тип покрытия, состояние ногтевой пластины, частоту нанесения маникюра, наличие возможных аллергических реакций и другие факторы.

При выборе грунтовки для использования дома, рекомендуется обращать внимание на следующие характеристики:

  • Концентрация кислоты в составе жидкости. На этот параметр необходимо обращать внимание, так как высокое содержание кислоты может повредить ногти, вызывать покраснение, жжение.
  • Производители выпускают праймеры под разными названиями. В продаже можно встретить бондер нейл-преп и другие вещества, но все они выполняют одинаковую функцию. Новичкам при покупке праймеров рекомендуется не зацикливаться на названии.

Отличия праймера от прочих маникюрных жидкостей: обезжиривателя, дегидратора и бондера

Учитывая обилие средств для маникюра, который есть на рынке, новичку сложно сделать выбор, какой из них покупать. Некоторые из них функционально схожи. Их главная задача – обеспечить надежное сцепление накладного вещества с родным ногтем

Если говорить об обезжиривателях, дегидраторах, бондерах, все эти вещества используются для удаления жира, частичек грязи, лишней влаги с ногтевой поверхности. Каждое вещество имеет специфику и четкое назначение. Праймер обезжиривает, дезинфицирует и подсушивает ноготь, обеспечивает высокую степень адгезии, поэтому накладная поверхность лучше и дольше держится.

Как наносить праймер: пошаговая инструкция

Применять праймер необходимо следующим образом:

  • Используйте пушер или апельсиновую палочку, чтобы отодвинуть кутикулу. Ноготь обработайте пилкой, чтобы убрать блеск. Далее смахните щеточкой пыль.
  • Чтобы нанести праймер, нужно набрать небольшое количество вещества на кисточку, не сильно ее отжать о край флакона, убрать лишнюю жидкость с помощью салфетки. Кисточку следует приложить к центру ногтя, позволив веществу растечься по всей поверхности ногтя равномерно. Нужно следить за тем, чтобы праймер не затек на околоногтевую кожу и кутикулу. Если это случилось, кожу нужно срочно промыть водой. Слой нужно делать тонким. Даже минимального слоя достаточно для хорошей адгезии, а при избытке жидкости велик риск того, что она попадет на кожу или чешуйки ногтя не поднимутся.
  • Жидкость быстро сохнет естественным путем на воздухе. Уже через минуту можно будет приступать непосредственно к наращиванию.

Если ногти наращиваются на типсах, важно не допустить попадания на них праймера. Это приводит к появлению трещин даже на продукции высокого качества.

Техника безопасности при работе

При работе с праймером необходимо соблюдать технику безопасности, особенно в случае, если используется кислотный:

  • помещение, в котором используется вещество, должно хорошо проветриваться;
  • наносить нужно один слой, второй при необходимости можно нанести при высыхании первого;
  • больше двух слоев применять не рекомендуется;
  • исключить попадание на кожу;
  • обработку необходимо вести в очках и защитных перчатках.

Наносить жидкость стоит аккуратно, предварительно убрав ее излишки из кисточки. Также не стоит забывать, что она очень быстро высыхает.


Обзор праймеров

ПРАЙМЕР FOR YOU БЕСКИСЛОТНЫЙ 10 МЛ

Обеспечивает прочное сцепление материала с ногтем и обезжиривает поверхность. Специально разработанная формула заботится о ногтевой пластине, препятствует ее разрушению, истощению и расслаиванию. Не вызывает раздражения кожи. Подходит для всех покрытий: гель, акрил, био-гель, гель-лак.

ПРАЙМЕР «FOR YOU» БЕСКИСЛОТНЫЙ 15 МЛ

Обеспечивает прочное сцепление искусственного материала с ногтем и обезжиривает поверхность. Делает ногтевую пластину гладкой, однородной, заполняя неровности и естественные трещины. Подходит для геля и акрила.

Бескислотный праймер FOR YOU УЛЬТРАБОНД 15 МЛ

Для профессионального маникюра. Данная грунтовка отлично обезжиривает, очищает обрабатываемую поверхность, что обеспечивает хорошую адгезию. Может использоваться практически для любых гель-лаков и гелевого наращивания. Высокий уровень сцепки ногтя с искусственным материалом минимизирует риск раннего отслоения.

ПРАЙМЕР FOR YOU КИСЛОТНЫЙ 10 МЛ.

Обеспечивает прочное сцепление искусственного материала с ногтем и обезжиривает поверхность. Делает ногтевую пластину гладкой, однородной, заполняя неровности и естественные трещины. Подходит для геля и акрила.

ПРАЙМЕР FOR YOU КИСЛОТНЫЙ 15 МЛ.

Обеспечивает прочное сцепление искусственного материала с ногтем и обезжиривает поверхность. Делает ногтевую пластину гладкой, однородной, заполняя неровности и естественные трещины. Подходит для геля и акрила.

Использование праймера – прекрасный способ минимизировать риск отслоения и значительно повысить срок службы маникюра. Нанесение грунтовки не является обязательной процедурой, но оно позволяет улучшить качество покрытия. На рынке встречаются разные виды праймеров для ногтей. Для использования дома выбирайте бескислотные грунтовки.

Следуйте основным советам и рекомендациям, используйте праймер для красивых ногтей и долгой носки маникюра.

Праймер битумный — ТЕХНОНИКОЛЬ

Праймер битумный эмульсионный – это водная эмульсия нефтяного битума, предназначенная для огрунтовки бетонного основания и цементно-песчаных стяжек. Материал наносится на основание перед тем, как на него укладывают самоклеящиеся и наплавляемые кровельные, гидроизоляционные материалы.

Изготавливается праймер битумный только из высококачественных битумов и органических растворителей. Этот фактор обеспечивает высокую теплостойкость и проникающую способность материала: праймер битумный способен впитываться глубоко в структуру обрабатываемых поверхностей, такое качество обеспечивает долговременный эффект. Праймер битумный отличается также отсутствием липкости и коротким временем высыхания, что делает его идеальным и незаменимым материалом для проклейки гидроизоляции.

Еще один плюс – праймер битумный производится в виде концентрата, что позволяет снизить расходы на хранение и транспортировку, а также делает материал более доступным. Кроме того, он отличается качественным сцеплением со склеиваемыми материалами.

Мастики и праймеры AquaMast

Чтобы применение праймера битумного было действительно качественным, необходимо придерживаться некоторых правил: перед использованием материал следует тщательно перемешать, а поверхность, на которую предполагается наносить праймер битумный, высушить и очистить от загрязнений, пыли, масла. Влажность поверхности должна быть не более 15%. После того, как праймер нанесен (с помощью валика, кисти или щетки), нужно дать ему время высохнуть: не менее 1 часа.

Современный рынок строительных материалов дает возможность выбрать наиболее подходящий вид праймера битумного из множества предлагаемых.


Праймер битумный ТЕХНОНИКОЛЬ №01 концентрат

Праймер битумный AquaMast

Праймер битумный ТЕХНОНИКОЛЬ №01

Праймер полимерный ТЕХНОНИКОЛЬ №08 Быстросохнущий

Праймер битумный ТехноНИКОЛЬ №04 морозостойкий

Для чего нужен праймер для лица, виды праймеров, что такое праймер

За последние 10 лет современная бьюти-индустрия открыла для нас большое количество новых косметических средств. Раньше наша косметичка спокойно обходилась без них, но теперь, все изменилось, и обычной тональной основы с пудрой уже недостаточно. Любой визажист сейчас скажет вам о необходимости использования праймеров.

Что такое праймер для лица?

Праймер – это специальное косметическое средство для разных типов кожи, предназначенное для того, чтобы скрыть видимые недостатки и неровности еще перед нанесением тонального средства или пудры, а также последующего нанесения других бьюти-продуктов.

Второе его название — фундаментальная основа под макияж, благодаря которой можно добиться эффекта идеальной кожи. Для чего нужен праймер? Благодарю нему  последующие косметические средства ложатся ровно, как бы сливаясь с тоном кожи. Это относится и к тональной основе, и к уже нашумевшим СС и ВВ кремам, ставших популярными благодаря корейскому рынку косметики.

Для чего нужен праймер для лица?

Мы уже выяснили, что такое праймер для лица, а теперь попытаемся выяснить конкретнее, для чего нужен праймер . 

Нанесение любого тонального средства подразумевает предварительное и правильное очищение кожи лица. Затем — использование тоника и подходящего увлажняющего крема, флюида и эмульсии. 

А для того, чтобы мейкап стойко держался в течение всего дня, праймер поможет создать так называемую “фундаментальную основу” под макияж, для того, чтобы текстура тонального средства максимально натурально смотрелась на лице, не скатывалась и держалась гораздо дольше.

Виды праймеров для лица

Сейчас на рынке косметики существует огромное количество разных праймеров. Какие они бывают, как правильно ими пользоваться, зачем нужен праймер для лица именно вам , попытаемся рассказать ниже.

1. Праймеры, корректирующие цвет лица.

Выбирая праймер, обязательно необходимо учитывать освещение, в котором вы находитесь в данный момент времени. К примеру, офисный свет зачастую содержит зеленоватый оттенок – таким образом, продукт подбирают, чтобы он скрывал такие  недостатки. Очень часто кожа склонна к различным покраснениям, поэтому обычный классический праймер не подойдет.

2. Праймеры, скрывающие пигментацию.

Пигментные пятна – одна из главных проблем, с которым сталкиваются современные люди. Стоит ли говорить, что солнце негативно влияет на состояние и текстуру кожи. Как следствие – наличие родинок, пятен. Праймеры, корректирующие данную проблему, имеют более плотную, светлую текстуру.

3. Матирующие праймеры.

Излишки себума, жирные блеск и высыпания на лице – признаки проблемной кожи. В таких случаях необходимо подбирать более легкие, невесомые текстуры, которые будут сливаться с текстурой кожи.

4. Антивозрастные праймеры. 

Морщины, заломы, сухость кожи – признаки возрастных изменений. Перед нанесением тональных средств, необходимо использовать праймер, который хорошо увлажнял бы кожу и скрывал складки. Обратите внимание на наличие витамина Е в составе антивозрастных праймеров – это поможет добиться необходимого результата. Использование антивозрастных праймеров в сочетании с японской косметикой Sensai, поможет добиться эффекта идеальной молодой кожи.

5. Праймеры, нацеленные на сияние кожи. 

Любители хайлайтеров по достоинству оценят праймеры, обладающие эффектом сияния. Такой продукт поможет не только визуально улучшить текстуру кожи, но и создать эффект свежего, отдохнувшего лица.

6. Масло праймер.

По-настоящему многофункциональный продукт, который можно использовать для увлажнения, для подготовки кожи к нанесению мейкапа.  Еще масло-праймер можно использовать для кутикулы.

7. Праймеры, минимизирующие поры.

Очень часто идеальный мейкап требует минимизации пор. Если они расширенные – кожа чаще всего склонна к загрязнениям и высыпаниям. Поэтому, лучше выбрать праймер, который хорошо выровняет текстуру кожи.

8. Увлажняющие праймеры.

Такие косметические средства подходят практически всем типам кожи. Ведь должное увлажнение необходимо даже жирной кожи. Стоит только правильно одобрать свой продукт.

 

9. Тревел-праймеры. 

Для тех, кто много путешествует, мини-версия данного продукта – отличное решение для тревел-косметички.

10. Праймеры в виде спреев для лица. 

Один из самых популярных видов праймеров. Фиксирует макияж, освежает его в течение дня. Одни из лучших праймеров для лица – это продукты американского бренда Smashbox.

 

Как правильно подобрать праймер для лица? 

Важно определить, какой у вас тип кожи –  в зависимости от этого вам будет легче определиться какой выбрать праймер.

Для проблемной кожи подойдут более легкие, водянистые консистенции, которые не будут создавать эффект маски и забивать поры. Такая косметика обязательно должна обладать матирующим свойством, убирая излишки себума и жирный блеск на лице.

Для сухой кожи отлично подойдут кремовые шелковистые текстуры. Такой продукт должен быть по-настоящему многофункциональным: увлажнять, бороться с преждевременным старением, визуально скрывать недостатки.

Как пользоваться праймером?

После того, как вы подобрали продукт, который подходит именно вашему типу кожи, необходимо взять на заметку несколько советов по его использованию:

1. Мягко очистите кожу с помощью пенки или геля для умывания.

2. Воспользуйтесь увлажняющим лосьоном для лица.

3. Используйте легкий уход: крем, флюид, эмульсию или антивозрастную эссенцию. Главное, чтобы средство не забивало поры. Не забудьте увлажнить кожу под глазами.

4. Равномерно тонким слоем нанесите праймер, избегая области вокруг глаз. 

5. Нанесите ваше тональное средство, затем закрепив его пудрой или специальным фиксирующим праймером-спреем.

Рассказать друзьям

Для чего нужен праймер для лица, и как им пользоваться

Каждая девушка, делая макияж, желает, чтобы он идеально скрывал недостатки и подчеркивал достоинства. Однако, в технике нанесения макияжа не все так просто.

Кроме того, что мы выравниваем цвет кожи, скрываем прыщики и черные точки с помощью тонального крема и пудры, мы должны понимать, что нам необходима база под этот самый макияж. Именно здесь на помощь приходит праймер для кожи лица. Итак, что же такое «праймер», основные виды, как приобрести подходящий, и как правильно его наносить? Об этом далее.

1

Что это такое

Ранее базу под макияж не использовали вообще. Если все-таки девушки знали о том, что базовый тон под основной тонального крема необходим, то пользовались увлажняющими кремами. Но в двадцать первом веке – это моветон.

Праймер является базой под макияж. Зачастую праймером пользуются обладательницы проблемной кожи, так как он помогает выровнять цвет лица и скрыть проблемные участки.

Однако, кроме таких свойств, праймер еще обладает отличной способностью «держать» макияж. То есть, если вы нанесли праймер как базу под косметику, будьте уверены, что ваш мейк-ап продержится весь день или вечер. Косметика не потечет.

2

Преимущества

Пользуясь праймером, вы всегда будете уверены, что ваша косметика выдержит высокие температуры, например, летом. Смело накладывайте базу под макияж, и мейк-ап останется на положенном месте;

В отличие от увлажняющих кремов, праймер не забивает поры. Такое свойство не оставит равнодушными девушек с проблемной или жирной кожей.

Особенно летом, когда наша кожа подвержена большому количеству пыли, когда она с легкостью потеет, праймер может спасти ваше лицо от проблем.

3

Виды по составу

4

Виды по цвету

  • Фиолетовый. Такой праймер придуман для девушек с землистым цветом кожи, поэтому он придает естественность и теплый оттенок;
  • Зеленый. Мастер по маскировке покраснений на коже, шероховатостей, черных точек и прыщей;
  • Оранжевый. Отлично подходит для маскировки синяков, к тому же прекрасно подходит для выравнивания цвета кожи;
  • Желтый. Также выравнивает оттенок кожи лица и подходит для тех, кто вечно не может выспаться, так как скрывает круги под глазами.

5

Пудинг-праймер

Пудинг-праймер является настоящим открытием.

Такой праймер идеально подходит для девушек с жирной кожей, которая склонна к блеску.

В отличие от праймеров с кремообразной консистенцией, пудинг-праймер имеет более твердую и сухую структуру, поэтому ваш макияж не будет растекаться.

Также он слегка подсушивает кожу, поэтому визуально мейк-ап будет выглядеть аккуратно, исчезнет жирный блеск и вы избавитесь от риска нечаянно размазать элементы макияжа.

6

Виды пудинг-праймера

  • На основе глины. Лучший помощник для девушек с жирной кожей. Имеет антисептические и противовоспалительные свойства. Кроме глины в основе может лежать кукурузный крахмал.
  • На основе шелка. Праймер для женщин после 35, чья кожа может считаться зрелой и иметь признаки старения. Пудинг-праймер такого типа обрадует вас антисептическими свойствами и эффектом матирования.
  • На основе зеленого чая. Такой праймер необходим девушкам с проблемной кожей, так как он отлично скрывает недостатки, покраснения, прыщи и угри, может заменить вам дневные и ночные крема, к тому же, обладает противовоспалительным эффектом.

7

Как правильно пользоваться

Если вы уже выбрали подходящий для своей кожи праймер, советуем ознакомиться с правилами и нюансами его использования.

  1. Наносим на кожу лица увлажняющий крем. Ждем, пока крем впитается;
  2. Аккуратно наносим праймер. Все праймеры, кроме праймера зеленоватого оттенка, наносятся на все лицо.
  3. Выдавите из тюбика небольшое количество на ладонь, подождите, пока праймер нагреется до комнатной температуры. Далее используйте спонж для лица, им наносите праймер на кожу. Начинайте сверху вниз. Глаза, нос, щеки, скулы, подбородок;
  4. Если вам кажется, что праймера недостаточно, можете нанести еще немного. В области носа и лба можно пальцами слегка втирать средство;
  5. Когда вы достигли желаемого эффекта, подождите несколько минут, чтобы ваша база под макияж впиталась. Следом выполняйте обычную технику макияжа, тональный крем или пудра.

Видео к материалу

Если вы увидели ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Понравилась инструкция?

2 Да Нет 0

Еще инструкции на эту тему:

Что такое праймер для макияжа и для чего он нужен?

Любите ли вы наносить макияж на все лицо каждый день или предпочитаете более упрощенный подход к красоте, праймер может стать лучшим дополнением к вашей косметичке. Если вы полностью отказываетесь от использования праймера, вы не одиноки! В большинстве случаев мы либо не знаем, как им пользоваться, либо просто не думаем, что нам это нужно. Чтобы узнать больше о важности праймера, мы поговорили с визажистом из Нэшвилла Челси Рейнольдс, которая создает образы для моды, красоты и особых мероприятий.

Что такое основа под макияж?

Праймер для макияжа — это крем, гель или жидкость, предназначенные для создания гладкой основы для вашего макияжа. Как и ваш тональный крем, он бывает с различными покрытиями — влажным, атласным или матовым — и заполняет поры, поглощает излишки кожного сала и выравнивает текстуру кожи, благодаря чему тональный крем становится более гладким, выглядит более естественным и держится намного дольше. Некоторые праймеры для макияжа предлагают небольшое покрытие для незначительных недостатков кожи, в то время как другие обеспечивают дополнительные преимущества по уходу за кожей, такие как увлажнение, омолаживание и защита от солнца, чтобы улучшить вашу кожу в течение длительного времени.

Однако праймеры

можно наносить не только на тональную основу, они выходят за рамки макияжа. Вот различные типы праймеров, что именно они делают и зачем они вам нужны.

  1. 1. Тональный праймер: создает гладкую основу для тонального крема

    .

    Воспринимайте грунтовку для фундамента так же, как грунтовку для краски для дома.Цель состоит в том, чтобы создать гладкий базовый слой перед нанесением последнего слоя. «Праймер не только обладает дополнительными преимуществами для кожи, такими как увлажнение и контроль кожного сала, — объясняет Рейнольдс, — он обеспечивает основу для нанесения макияжа. Праймер действительно увеличивает стойкость вашего макияжа и предотвращает появление складок в течение дня». Праймеры
    Foundation не являются универсальными, и не все они дают одинаковые преимущества. Чтобы помочь вам найти правильный праймер для вас, всегда разумно учитывать свой тип кожи и проблемы.Чтобы получить легкий, защищающий от солнца и улучшающий цвет лица холст, попробуйте Colorescience Skin Perfector Brightening Primer SPF 20.

    Купить сейчас с бесплатной доставкой
  2. 2.Праймер для век или теней для век: предотвращает скатывание теней для век

    Вы заметили, что ваши веки становятся немного жирными в течение дня? Вы когда-нибудь замечали, что ваши тени для век мнутся или что пигмент тускнеет слишком быстро? Праймер для век может быть именно тем, чего не хватает в вашем обычном макияже. «Праймер для век не только усиливает пигментацию ваших теней, но и предотвращает образование складок», — говорит Рейнольдс. «Праймеры для век позволят вашему макияжу глаз ложиться плавно и сохранять яркость в течение всего дня.”
    В качестве увлажняющего праймера, который также можно использовать для ухода за кожей под глазами, попробуйте осветляющий праймер для век Jouer Cosmetics Long-Wear Eye Brightening Primer.

    Купить сейчас с бесплатной доставкой
  3. Купи сейчас с Дермстор

    3.Праймер для ресниц: делает ваши ресницы гуще и длиннее

    Если вы ищете более сильные и густые ресницы (правда, не все ли мы?), праймер для ресниц — отличный выбор для вас. Праймер для ресниц удлиняет ресницы, а в некоторых случаях также может стимулировать их рост. Он также создает прекрасную основу для вашей туши, которая продлевает ее стойкость. Рейнольдс говорит: «Я люблю праймер для ресниц, потому что он отлично подходит для кондиционирования ресниц и подготовки их к нанесению туши.”
    Чтобы укрепить ваши ресницы от корней до кончиков, мы рекомендуем PureLash Extender and Conditioner от jane iredale.

    Купить сейчас с бесплатной доставкой
  4. Купи сейчас с Дермстор

    4.Праймер для ногтей: защищает ногти и продлевает срок службы лака

    Праймер предназначен не только для совершенствования макияжа. Праймер также может изменить правила игры для наших ногтей. Этот многоцелевой продукт помогает нашему лаку дольше держаться и защищает наши ногти от сколов. «Я люблю грунтовку для ногтей, потому что она помогает укрепить мои ногти и защитить их от лака, поэтому они не обесцвечиваются», — говорит Рейнольдс.
    Наш любимый стойкий праймер для ногтей — это Smith & Cult’s Basis of Everything.
     

    Купить сейчас с бесплатной доставкой
  5. Купи сейчас с Дермстор

    5.Праймер для волос: защищает волосы от жары и влаги

    Праймер для волос создает барьер, помогающий защитить волосы от горячей укладки, влажности и многого другого. «Праймеры для волос отлично подходят для создания дополнительного слоя защиты», — объясняет Рейнольдс. Она также рекомендует использовать грунтовку для волос, чтобы «свести к минимуму тепловое или химическое повреждение».
    Некоторые праймеры для волос, такие как TWISTER Curl Primer от R+Co, также увлажняют волосы и придают им форму, защищая их от теплового повреждения.

    Купить сейчас с бесплатной доставкой

Использование праймера для макияжа — почему использование праймера для лица обязательно — Maybelline India

Бывают случаи, когда, как бы хорошо вы ни смешивали тональную основу и консилер, макияж лица будет выглядеть неправильно.Он преувеличивает ваши поры, выглядит полосатым и очень легко сминается. Все эти беды имеют одно решение, грунтовка. Небольшая ложка хорошего праймера для лица размывает поры, разглаживает кожу и делает макияж красивым. Давайте погрузимся и узнаем больше об использовании праймера для макияжа и о том, для чего используется праймер для лица.

Для чего используется база под макияж?

Использование праймера для макияжа помогает подготовить кожу и создает идеальную основу для макияжа, который вы наносите поверх.Вы также можете использовать его, чтобы подготовить веки, чтобы макияж глаз оставался на месте.

На рынке представлены различные типы грунтовок, каждая из которых имеет разную текстуру и предназначение. Праймером может быть сыворотка, которая увлажняет лицо, или солнцезащитный крем, который сужает поры и разглаживает кожу. Тем не менее, наиболее распространенным и эффективным праймером является праймер на основе силикона, который разглаживает кожу, скрывает поры и слегка липнет при нанесении. Эта липкость помогает вашему макияжу лучше держаться на нем и помогает ему держаться дольше.

Поначалу использование праймера для лица может показаться уловкой, но это продукт, который изменит вашу игру в макияже. Вот несколько дополнительных преимуществ использования праймера перед макияжем:

1. Использование праймера не только скрывает поры и разглаживает кожу, но и помогает уменьшить выработку кожного сала в течение дня.

2. Использование праймера под макияж лица также осветляет кожу и улучшает ее текстуру, что помогает добиться ровного нанесения макияжа.

3. Использование праймера для лица также гарантирует, что ваш макияж не скатится и не осядет на тонких линиях, а также обеспечит его стойкость в течение всего дня.

4. Праймер используется для продления стойкости макияжа. В долгие дни в жару или на мероприятии, которое нужно посетить, праймер поможет вашему макияжу держаться в течение длительного периода времени.

5. Если ваш контур, румяна или хайлайтер выглядят пятнистыми, это происходит из-за расширенных пор. Праймер проникает в эти поры и помогает вашему средству макияжа плавно ложиться на кожу.

6. Если у вас есть склонная к акне кожа или сухие пятна на коже, использование праймера под макияж поможет выровнять их и не позволит продуктам осесть на них.

Как правильно наносить грунтовку?

— Через пару минут после того, как вы закончите с уходом за кожей, и перед началом макияжа лица, вы наносите праймер.

— В отличие от других продуктов для макияжа, для нанесения праймера не нужны специальные инструменты. На чистые пальцы возьмите количество вашего любимого праймера размером с горошину и осторожно согрейте его между пальцами.Не нужно намыливать кожу праймером, нужно совсем небольшое количество.

— Нанесите праймер на кожу на Т-зоне, подбородке, лбу и в местах с расширенными порами. Аккуратно вдавите его в кожу, используя восходящие или круговые движения.

— Подождите минуту, прежде чем начать макияж лица. Это поможет праймеру хорошо впитаться в кожу и закрепиться на месте.

Применение грунтовки таким образом и с использованием правильных инструментов полностью изменит правила игры. Это создаст огромную разницу в том, как будет выглядеть ваш конечный результат.Через минуту можно приступать к нанесению тонального крема и консилера. Если у вас возникли проблемы с поиском идеального оттенка тонального крема и консилера, вы можете воспользоваться инструментом Maybelline Foundation Finder, чтобы найти идеальное сочетание. С помощью этого инструмента вы можете практически попробовать все оттенки и выбрать тот, который подходит именно вам.

После того, как вы закончите с макияжем лица, вы можете приступить к макияжу глаз. Если у вас очень жирные или морщинистые веки, вы можете использовать праймер для глаз, чтобы сгладить их.Если вы не хотите использовать праймер для глаз, просто нанесите очень немного праймера для лица на веки и дайте ему впитаться, он будет иметь аналогичный эффект. После этого вы увидите, как тени и подводка легко ложатся на глаза. После того, как вы нанесли толстый слой туши для глаз, вы можете завершить свой макияж макияжем губ. Найдите свой идеальный оттенок помады с помощью инструмента виртуальной примерки от Maybelline. Этот инструмент поможет вам попробовать свои любимые продукты, включая губную помаду, тени для век, карандаши для бровей и т. д., в режиме реального времени и не выходя из дома.

Лучший праймер для жирной кожи

Базар Харпера

Если у вас жирный цвет лица, хороший праймер является ключом к красивому нанесению макияжа. Найдите правильный вариант, и он предотвратит сползание вашего основания, тем самым дольше сохраняя его гладким и безупречным.

Хороший матирующий праймер не только справится с сильно блестящими участками, но и сгладит мелкие морщинки и поры, в результате чего цвет лица станет гладким, ровным, без ощущения стянутости или пятен.

При поиске лучшего праймера подумайте о конечном результате, которого вы надеетесь достичь. Для этой бархатистой матовой ультрагладкой текстуры идеально подойдет грунтовка на силиконовой основе. Шелковистые и легко наносимые, эти формулы скользят по коже, размывая поры и морщины.

Для склонных к угревой сыпи праймер, усиленный очищающими ингредиентами, такими как гамамелис или салициловая кислота, сохранит вашу кожу чистой в течение дня. А для тех, у кого кожа склонна к раздражению или покраснению, рассмотрите грунтовку с зеленым оттенком, которая нейтрализует покраснение и создает единый холст для основы.

Здесь см. Bazaar подборка самых лучших праймеров для склонных к жирности.

Лучшие праймеры для жирной кожи, которые стоит попробовать прямо сейчас

Реклама — продолжить чтение ниже

Праймер Плюс Матирующий

Бобби Браун lookfantastic.com

£25.00

Праймер для жирной кожи

Bobbi Brown обеспечивает полуматовое покрытие, которое хорошо сочетается как с влажными, так и с матовыми тональными средствами.Попробуйте его с стиками, жидкостями и порошками сверху: это по-настоящему понравится публике.

Силиконовый праймер с высокой адгезией

Обычный beautybay.com

4,50 фунта стерлингов

Настоятельно рекомендуемый для жирной кожи, культовый праймер The Ordinary известен тем, что сохраняет макияж на месте, увлажняет цвет лица, гарантируя, что блеск и выцветание не будут проблемой к обеду.Он скрывает поры и тонкие линии, делая кожу гладкой, но легкой.

Ваниш Праймер для аэрографа

Песочные часы www.cultbeauty.co.uk

£50.00

Hourglass известен своими выдающимися базовыми продуктами, и последнее дополнение к линейке Vanish с полным покрытием не разочаровывает. Этот крем на основе силикона при нанесении превращается в прозрачный гель и ощущается достаточно «упругим», чтобы скользить по порам и текстуре, создавая по-настоящему гладкий холст без блеска.Нанесите это под жидкую основу, и вам не нужно будет использовать пудру поверх.

Perfect Canvas Clean Primer

РЕН lookfantastic.com

£42.00

Умный праймер

Ren не содержит силикона, поэтому подходит для людей, склонных к акне, а также может похвастаться реальными преимуществами по уходу за кожей.

Обогащен альфа-глюканами, пробиотиками и экстрактом голубой агавы, которые увлажняют и балансируют кожный барьер, благодаря чему ваш макияж со временем выглядит все лучше и лучше.

Осветляющий праймер с витамином С SPF 15

Доктор Себаг Libertylondon.com

£55.00

Великолепный гибрид для ухода за кожей и макияжа, этот праймер делает все: от сглаживания пор до осветления тона и даже защиты от загрязнений. Он насыщен гиалуроновой кислотой для увеличения объема и витамином С для антиоксидантной защиты. На самом деле, он даже отлично выглядит без основы сверху.

Studio Fix Mattifine 12 Hour Shine-Control Primer

МАК lookfantastic.com

£28.00

Новый праймер MAC

предназначен для сглаживания расширенных пор и борьбы с избыточным блеском – и он превосходно справляется с обоими задачами. Безмасляная формула имеет силиконовую основу, которая создает этот ультрагладкий холст, и усилена полигидроксикислотой, которая слегка отшелушивает кожу.Если вы ищете что-то, что сделает вашу тональную основу гладкой, как шелк, отмените поиск.

Synchro Skin Soft Размытие Праймер

Шисейдо www.cultbeauty.co.uk

£32.00

Кремовая формула

Shiseido — самая легкая из всех, она обеспечивает ощущение комфорта и увлажнения, а также повышает стойкость вашего тонального крема. Это блестящий вариант для тех, кто любит легкое и сияющее покрытие.

Праймер для размытия Pure Canvas

Лора Мерсье feelunique.com

28,90 фунтов стерлингов

Один из ряда целевых праймеров, эта формула размытия от Laura Mercier не содержит масла и силикона, а это означает, что при нанесении она не будет тяжелой и не будет шелушиться. Лучше всего то, что он впитывает излишки кожного сала, создавая естественный матирующий эффект, который помогает вашему макияжу красиво наноситься.

Infallible Primer Shot Праймер против покраснений

Л’Ореаль Париж выглядеть фантастически.ком

£8,99

Если ваша жирная кожа сочетается с покраснениями и пятнами, вам может подойти грунтовка с зеленым оттенком, а не гель на основе силикона. Эта увлажняющая формула замечательно нейтрализует красные тона кожи, а это значит, что вы можете носить ее отдельно в качестве легкой основы или наносить под тональную основу, чтобы не допустить перегревания прыща.

Pro Filt’r Матирующий праймер

Фенти харвейниколы.ком

£24.00

Если вы предпочитаете избавляться от жирного блеска кожи, но при этом не хотите, чтобы цвет лица стал слишком матовым, вам понравится специальный праймер Рианны.

Не чувствуйте себя обязанным покрывать весь цвет лица: он прекрасно работает в качестве точечного средства для борьбы с избытком кожного сала вокруг Т-зоны, носа и подбородка.

Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты.Вы можете найти дополнительную информацию об этом и подобном контенте на сайте piano.io.

Реклама — продолжить чтение ниже

Букварь по букварю — Школа да Винчи

Что такое грунтовка?

Букварь — это переходный год между детским садом и первым классом. Primer дает возможность учащимся развиваться социально, эмоционально и академически в период между детским садом и 1-м классом. Этот год позволяет ребенку взрослеть в своем естественном темпе, продолжая при этом прогрессировать в учебе.

Рекомендация рассмотреть букварь не является замечанием по поводу интеллекта ребенка; это комментарий о развитии этого ребенка. Поскольку дети развиваются с такой разной скоростью, а возраст детского сада может составлять от пяти до семи лет, существует огромный диапазон социального, физического и когнитивного развития.

 

На что обратить внимание

 

Возраст — У многих учеников начальной школы дни рождения выпадают на конец учебного года.

 

Развитие — Некоторым может потребоваться больше практики с мелкой моторикой, в то время как другим будет полезно больше возможностей для развития социальных навыков.

 

Школа — В школах Далласа установлен разный возраст для зачисления в школу. Некоторые не зачислят ребенка с поздним днем ​​рождения. Некоторые зачисляют большое количество детей старшего возраста; это означает, что возраст может варьироваться на целых полтора года.

 

Обстоятельства — Небольшое и любящее окружение да Винчи может быть полезным для ребенка, испытывающего трудности вне школы.Наши классы маленькие, безопасные и теплые. Da Vinci может быть местом комфорта еще на один год.

 

Букварь на да Винчи

 

Наш курс для начинающих индивидуализирован, чтобы поддержать сильные стороны и проблемы каждого ученика. Например, у одного ребенка могут быть очень сильные навыки чтения, но ему нужно время для социальной зрелости. По мере взросления дети встречаются с деятельностью более высокого уровня мышления. В то время как наши первоклассники делят класс с детсадовцами, они получают задания, направленные на повышение их зрелости и знаний.Мы прививаем, и начинающие да Винчи гордятся тем, что они занимают руководящие должности в качестве наших старейших учеников. Учебник — это год, чтобы вырастить уверенность и чувство собственного достоинства и поделиться тем, что они узнают, с другими.

 

«Подарок времени»

Мы слышали, как бесчисленное количество родителей говорят, как они были благодарны за то, что отдали своего ребенка в букварь. Единственные сожаления, которые мы слышали, исходили от семей, которые пожалели, что не сделали такой выбор.

Вопросы?

 

Учитель вашего ребенка, воспитатели нашего детского сада или Мэри Энн будут рады обсудить с вами варианты размещения в любое время.

Основы под макияж

| HowStuffWorks

Если вы когда-нибудь задумывались, откуда у моделей такая сияющая, безупречная кожа, ответ может заключаться в их праймере под макияж. Поскольку праймер для макияжа обладает уникальной способностью заполнять тонкие линии и морщины, использование праймера в качестве слоя между вашей кожей и тональной основой обеспечивает основу, необходимую для создания идеальной кожи в любом возрасте [источник: WebMD].

«Защита от расплавления» — обычное модное слово, связанное с праймерами, но есть несколько преимуществ нанесения слоя праймер-геля, помимо простого продления срока службы вашего тонального крема.Праймер может помочь предотвратить неприглядные складки на тенях для век и полосы на тональной основе, он может контролировать появление блеска и может предотвратить шелушение макияжа [источник: WebMD].

Существует множество доступных праймеров, которые подходят для любого типа кожи: они могут быть прозрачными или тонированными, увлажняющими или подсушивающими, а также специальными составами для разных частей лица. На самом деле, выбор правильного праймера для вашего типа или тона кожи ничем не отличается от выбора правильного тонального крема.

Хотя добавление еще одного шага к утренней маршрутизации может показаться пугающим, вы можете обнаружить, что результаты использования праймера стоят нескольких минут, потраченных на его нанесение.Независимо от того, нужен ли вам маленький мазок или большая ложка, эти быстродействующие гели можно наносить и закреплять в течение времени, необходимого для чистки зубов и использования зубной нити. Следуя той же технике нанесения, что и увлажняющий крем, вы можете нанести праймер на щеки, глаза и губы. Небольшой дополнительный праймер на участках, где цвет тускнеет, может впоследствии исключить пудру или промокание [источник: Langton].

Праймеры сводят к минимуму мелкие морщинки, временно удаляют темные пятна и закрепляют основу для покрытия макияжа, которое сохраняется на протяжении всего рабочего дня.Читайте дальше, чтобы узнать, как небольшое количество праймера может творить чудеса с вашим внешним видом.

 

 

Расчет концентрации праймера и зонда | Thermo Fisher Scientific

В следующих случаях вам потребуется рассчитать концентрацию праймеров или зондов в растворе:

  • Вы впервые синтезировали собственные праймеры или зонды, но не знаете, как рассчитать их концентрацию.
  • Вы не восстанавливали и не извлекали весь лиофилизированный (сублимированный) порошок из пробирки, содержащей праймер или зонд, поэтому вы не уверены в исходной концентрации.
  • У вас есть исходный раствор праймера с ранее известной концентрацией, который не маркирован или маркирован неправильно, поэтому вы не знаете его концентрацию.

В качестве альтернативы вам может быть трудно рассчитать количество жидкости, необходимое для восстановления известной массы лиофилизированного праймера или зонда, чтобы достичь желаемой концентрации для ваших рабочих материалов.

Если какие-либо из этих проблем кажутся вам важными, следующие простые примеры содержат советы по их преодолению.-12) молей на литр.

Начнем с примера исследователя, впервые синтезировавшего праймеры. Они намеревались использовать праймеры для обнаружения экспрессии фактора роста эндотелия сосудов (VEGF) в фибробластах человека. Исследователь получил неизвестное количество синтезированных праймеров в буфере, и ему нужно было рассчитать концентрацию праймеров в этом растворе, чтобы правильно его использовать. Простая формула может решить эту задачу, но сначала нам нужно получить дополнительную информацию.

В этом примере передняя цепь праймера (ориентация от 5’ к 3’) читается как CAAGACAAGAAAATCCCTGTGG. Первым шагом в этом процессе является спектрофотометрический анализ праймера для определения его поглощения при 260 нм (известного как A260). Чтобы не тратить драгоценный праймер, исследователь разбавил его 1:100 в буфере 1X TE, чтобы получить конечный объем 1 мл (10 мкл раствора праймера и 990 мкл 1X TE — это коэффициент разбавления 100 ). . Затем исследователь определил A260 разведенного образца, который составил 0.135 , и принял к сведению длину оптического пути кюветы, используемой в спектрофотометре, которая составляла 0,4 см . Подводя итог, исследователь располагает следующей информацией: A260 анализируемого образца праймера ( 0,135 ), его коэффициент разбавления ( 100 ) и длина пути используемой кюветы ( 0,4 см ).

Однако исследователю нужно было получить еще один кусочек головоломки, прежде чем они смогли применить формулу. Им нужно было рассчитать сумму вкладов азотистых оснований в коэффициент экстинкции в цепи праймера.Это может показаться сложным, но это не так: по сути, каждому азотистому основанию (аденину, цитозину, гуанину и тимину) в цепи присваивается значение, и нам просто нужно их сложить.

Вот значения, которые необходимо применить к каждому из четырех азотистых оснований. Эти значения известны как коэффициенты экстинкции хромофора, и если вы используете этот метод, вам нужно будет применить их к последовательности праймеров.

9400

нуклеотидных

хромофора коэффициент экстинкции

15200

С

7050

G

12 010

12 010

T

T

T

8400

Итак, для праймера в этом примере (Caagacaagaaatccccccctgtgg), есть:

9 AS: (15200 x 9)

5 Cs: (7 050 x 5)

5 Gs: (12 010 x 5)

3 Ts: (8 400 x 3)

Складываем.-1

Получив эту информацию, исследователь смог применить следующую формулу для расчета концентрации праймера в молях/литр [1].

Концентрация в молях/литр (C) = (коэффициент разбавления × A260) ÷ (сумма вкладов коэффициента экстинкции × длина пути кюветы)

В нашем примере это будет:

C = (100 x 0,135) ÷ ( 257 300 x 0,4)

C = 13,5 ÷ 102 920

C = 0,000131 M

Это число моль/литр немного громоздко, поэтому мы можем преобразовать его в микромоль, умножив значение на 10^6, чтобы получить окончательную концентрацию .

C = 131 мкМ

Что, если мы хотим рассчитать концентрацию олигонуклеотидных зондов с флуоресцентными метками? Процедура почти идентична, с одним ключевым отличием: нам нужно учитывать коэффициенты экстинкции хромофора красителей в зонде, прежде чем применять ту же формулу.

Вот некоторые коэффициенты экстинкции хромофора для широко используемых красителей.

Краситель

хромофора коэффициент экстинкции

FAM

20958

TAMRA

31980

ТЕТ

16255

JOE

12000

ВИКИ

30100

Для простоты, мы будем использовать олигонуклеотидную нить в приведенном выше примере (CAAGACAAGAAAATCCCTGTGG ), но на этот раз предположим, что исследователь синтезировал его как зонд и к 5′-концу присоединен краситель FAM, а к 3′-концу — краситель TAMRA.

В этом сценарии используется та же формула, что и в первом примере для начинающих, и мы выполняем вычисления таким же образом. Теперь, однако, мы должны добавить коэффициенты экстинкции двух красителей при вычислении суммы.

Итак, для зонда в этом примере (краситель TET – CAAGACAAGAAAATCCCTGTGG – краситель JOE) имеются:

9 As: (15 200 x 9)

5 Cs: (7 050 x 5) x 5)

3 Ts: (8 400 x 3)

1 краситель FAM: (20 958 x 1)

1 краситель TAMRA: (31 980 x 1)

Складываем.

(15 200 х 9) + (7 050 х 5) + (12 010 х 5) + (8 400 х 3) + (20 958 х 1) + (31 980 х 1)

136 800 + 35 250 + 60 050 + 20 0159 + 25 200, = 310 238 М-1см-1

Затем исследователь может использовать эту сумму вкладов коэффициентов экстинкции в формулу точно так, как описано выше, и все остальные аспекты расчета остаются прежними.

C = (100 x 0,135) ÷ (310 238 x 0,4)

C = 13,5 ÷ 124 095

C = 0,000109 М (109 мкМ)

в виде лиофилизированного порошка с массой в пикомолях (пмоль — см. список единиц выше) и требует восстановления в буфере перед использованием.Если вы пытаетесь рассчитать необходимое количество жидкости для восстановления известной массы лиофилизированного праймера или зонда до желаемой концентрации, следующий пример внесет ясность.

Во-первых, определите концентрацию, необходимую для вашего рабочего материала. Для праймеров это обычно колеблется от 10 до 100 мкМ, а для зондов от 2 до 10 мкМ. Давайте рассмотрим пример, чтобы рассчитать объем буфера, необходимый для восстановления праймеров в желаемой концентрации.

Исследователь покупает лиофилизированный праймер для EFNB2, гена, участвующего в росте кровеносных сосудов.6 = 0,120 мкмоль

Как только исследователь узнал массу праймера в мкмоль, он смог использовать следующую простую формулу [2] для расчета объема жидкости в литрах, необходимого для его восстановления до конечной концентрации 60 мкМ.

Объем в литрах = масса растворенного вещества ÷ желаемая концентрация

В этом случае: Объем в литрах = 0,120 мкмоль ÷ 60 мкмоль

Объем в литрах =  0,002 л

Мы можем преобразовать этот объем в более удобную единицу измерения, мл, умножив на 1000 (поскольку в 1 л 1000 мл).

0,002 x 1000 =  2 мл

Если исследователь восстановит праймер EFNB2 в 2 мл жидкости (например, 1X TE-буфера), он достигнет конечной концентрации 60 мкМ. Затем раствор можно разделить на аликвоты и хранить до тех пор, пока он не понадобится.

Как мы показали, расчеты для определения концентраций праймеров и разведений несложны, и если вы поработаете с приведенными здесь примерами, вы сможете с уверенностью и точностью приготовить и использовать рабочие растворы олигонуклеотидов.

Каталожные номера

1. TaqMan Fast Virus 1-Step Master Mix, руководство по эксплуатации (см. стр. 26). Чтобы лучше понять, как работает ваша косметика (и необходимость каждого продукта), полезно подумать о буквальном значении их названий.Основа — это именно то, что закладывает основу для всех последующих продуктов. он помогает конкретизировать даже самые утопленные формы губ, выделение акцентирует внимание на выступающих точках структуры кости, а грунтовка помогает подготовить холст, чтобы все это произошло.С таким количеством праймеров на рынке (и многие бренды предлагают несколько разных праймеров только в своих коллекциях), выбор правильного праймера для кожи, склонной к акне, может показаться тяжелой битвой. К счастью, дерматологи и эксперты по коже указывают на несколько ключевых ингредиентов, которые значительно облегчают поиск идеального праймера, благоприятного для пор.

При правильном использовании отличный праймер может стать разницей между стойким на весь день лицом и помятым, выцветшим макияжем. И наоборот, праймер, не соответствующий индивидуальным потребностям вашей кожи, особенно склонной к акне, может закупоривать поры, вызывая волну раздражения и высыпаний.

По словам доктора Эллен Мармур, дерматолога и основателя Marmur Medical, просмотр списка ингредиентов перед покупкой — это способ узнать, подходит ли праймер для чувствительной кожи с акне. «Всегда ищите гиалуроновую кислоту и глицерин, — советует она, — чтобы увлажнить и исцелить кожу, не забивая поры». Подтвержденные доктором Хайди Уолдорф, дерматологом и основателем Waldorf Dermatology Aesthetics, эти ингредиенты «действуют как губка, втягивая влагу в кожу и удерживая ее, а также увлажняют кожу и уменьшают шелушение, не раздражая кожу.

Подробнее: Как лечить грибковые прыщи на лице, когда ничего не помогает

Но праймеры предназначены не только для подготовки кожи к нанесению консилеров и тональных основ. Если вы выберете праймер, наполненный мягким отшелушивающим средством, таким как гликолевая кислота, наполненная AHA, вы эффективно боретесь с прыщами , в то время как маскирует их — настоящий сценарий лучшего из двух миров. «Идеальный продукт должен стимулировать отшелушивание пор, одновременно увлажняя кожу, и не вызывать слишком сильного раздражения», — объясняет доктор.Адебола Деле-Майкл, медицинский директор отделения дерматологии и лазерной терапии лучистой кожи в Нью-Йорке. Деле-Майкл добавляет, что AHA-кислоты, такие как гликолевая кислота, работают на кожу, потому что они не вызывают слишком сильного раздражения, что идеально, учитывая, что макияж предназначен для улучшения, а не воспламенения.

Posted in Разное

Добавить комментарий

Ваш адрес email не будет опубликован.