Праймеры что такое: зачем нужен и как пользоваться

Праймеры что такое: зачем нужен и как пользоваться

24.09.1993

Содержание

Что такое праймер и как правильно его использовать в макияже?

В жизни каждого человека с каждым днем появляется все больше новых малопонятных и незнакомых слов. Одним из таких является слово «праймер». Услышав его, многие женщины задаются вполне логичным вопросом: что же это такое и для чего он используется? Чтобы узнать ответ на этот вопрос, можно посетить курсы визажа от BM-Center или кратко ознакомиться с нашими соображениями на этот счет в данном материале.

Сразу же хотелось бы отметить, что праймер – это особая «штука» для лица, которая используется в самом начале, еще до того, как вы начинаете наносить на кожу лица какие-либо косметические средства. Главное назначение этого приспособления — сохранить макияж в целости и сохранности в течение долгого времени и сделать кожу идеально гладкой и ровной, как бы заполняя все изъяны и недостатки. Используя праймер, вы можете быть уверены в том, что ваш мейк не «поплывет» в самый неподходящий момент.

Качественный праймер – это настоящая палочка-выручалочка для тех женщин, для которых важно, чтобы макияж был опрятным и «свежим» в течение всего дня. Праймер поможет не только сделать макияж более стойким, но и позволит скрыть такие дефекты кожи, как небольшие прыщики, морщины, или рубцы. Кроме того, после использования праймера дневной крем и тональная основа лягут на кожу более тонким слоем. Это значит, что весь мэйкап будет выглядеть более естественно и привлекательно. Еще одно немаловажное достоинство праймеров – наличие солнцезащитного фактора. После нанесения этого средства вашей коже будут не страшны вредные УФ-лучи, благодаря чему она долгое время сможет сохранять свою молодость и свежесть.

Поскольку косметическая индустрия предлагает большой выбор различных видов праймеров, разобраться в столь большом разнообразии человеку без опыта и определенных знаний бывает довольно непросто. Для этого следует ознакомиться с основными видами праймеров, которые бывают:

Светоотражающие                               

Название говорит само за себя. В состав такого средства включены специальные светоотражающие частички, которые делают кожу сияющей при любом освещении. Наиболее часто такие праймеры используются для создания вечернего образа, или для того, чтобы сделать более выразительными и сияющими некоторые участки лица в дневном макияже.

Силиконовые

Силиконовый – не значит неестественный и плохой. С помощью такого средства можно с легкостью скрыть любые изъяны кожи, после чего она приобретет более здоровый и ухоженный вид. Силиконовый праймер – идеальный вариант для жирной, нормальной или комбинированной кожи лица, а также для тех женщин, на лице у которых имеется большое количество глубоких и не очень морщин.

Минеральные

Основное назначение таких праймеров – скрыть покраснения на коже. Именно поэтому практически все средства такого типа имеют зеленоватый оттенок, благодаря которому и удается добиться маскирующего эффекта. Минеральный праймер – то, что нужно женщинам, у которых проблемная кожа, склонная к появлению угрей или акне.

Независимо от того, какому типу праймера вы отдадите предпочтение, добиться максимального эффекта от нег удастся лишь при соблюдении правил:

  1. Наносите средство на увлажненную кожу.
  2. Выбирайте праймер, оттенок которого максимально приближен к вашему естественному цвету кожи.
  3. Наносите средство кончиками пальцев легкими вбивающими движениями, уделяя особое внимание так называемым «проблемным зонам». После нанесения средства позвольте ему полностью впитаться в кожу и только после этого приступайте к дальнейшему нанесению мэйка.

Если вы хотите более детально ознакомиться со всеми тонкостями создания неотразимого макияжа с использованием всех современных средств и техник макияжа, то можете посетить курсы визажа от BM-Center и стать еще на шаг ближе к своей мечте – быть профессиональным визажистом и стать ближе к миру индустрии красоты.

возврат к списку

Что такое праймер и как его правильно наносить? | ПульсПлюс

Праймер — это средство, применяющееся для макияжа перед тем, как на лицо наносится тональник. Основная задача этого средства — удерживание макияжа длительное время. Кроме того, он, как и тональник, выравнивает основной тон кожи и защищает кожу и поры от вредного воздействия со стороны. Раньше его использовали только профессионалы, но теперь он стал достоянием обычных пользователей индустрии красоты. Здесь будет рассказано, как и для чего используется это средство.

Стойкость и защита

Профессиональное средство поможет достичь безукоризненного эффекта от макияжа. Не последним параметром идеального макияжа является время, что он держится на лице, сохраняя прежнее впечатление. И праймер значительно удлиняет это время. Как это происходит? Он взаимодействует с веществами, которые кладутся на него и увеличивает их стойкость ко всем внешним воздействиям, будь то ветер или влага.

Защищает праймер и кожу. Причем защищает он ее как от воздействия косметики, утомляющей кожу лица, так и от внешних факторов, будь то вредные вещества в атмосфере или просто грязь, что не должна попадать в поры, закупоривая их. Средство заботится и о состоянии кожи, увлажняя ее, защищая от солнечных лучей, делая ее мягче.

Выравнивание тона и рельеф

Идеальный макияж должен лежать не только долго, но и хорошо, гладко, ровно и эффектно. Во многом праймер этому способствует, так как он делает кожу более ровной, скрывает мелкие дефекты на лице, создавая идеальную поверхность для профессионального макияжа. Из-за этого и тональник ложится куда лучше, не вредя коже и создавая эффект идеально ровного лица.

Праймер помогает тональному крему выровнять основной тон лица. Он не может заменить крем целиком и полностью, но он может скрыть покраснения или белые точки на лице. После него тональник ложится куда лучше и доводит эффект ровного тона до совершенства. То есть средство помогает тем, у кого кожа склонна к жирности и незначительным дефектам цвета.

Состав праймера: силиконовый или кремовый

Составы делятся по текстуре и механизму действия. Сначала рассмотрим первую классификацию. Существуют силиконовое и кремовое средство, праймер-лосьон и праймер-масло. Разберем их все.

Силиконовый праймер нужен для того, чтобы выровнять рельеф кожи — он сужает поры, сглаживает ямочки и небольшие ранки на лице, скрывает маленькие прыщики и прочие неудобные и неприятные мелочи. Он делается как гель, поэтому подходит для любой кожи, кроме проблемной, и почти не ощущается на лице. Помимо прочего он бесцветный, так что не нужно учитывать, как он отразится на финальном результате мейкапа.

Кремовый праймер можно использовать на абсолютно любой коже, главное, чтобы не было аллергии на ингредиент. Он не только выравнивает тон лица и скрывает небольшие дефекты, но еще и хорошо увлажняет поверхность лица. На него очень хорошо ложится тональник, а кожа после применения остается нежной и свежей.

Состав праймера: лосьон или масло

Праймеры-лосьоны, они же жидкие праймеры, делаются на основе воды. Они вызывают куда более спокойную реакцию со стороны кожи, чем средства на масляной или, тем более, на спиртовой основе. Кроме того, важное качество жидких средств — легкость, они почти не ощущаются на коже. Они оказывают на кожу увлажняющий эффект, помимо основной функции (выравнивание тона). Кроме того, лосьон подойдет для жирной кожи, а также девушкам с комбинированным типом кожи.

Праймер-масло тоже помогает коже, но он работает не столько на увлажнение, сколько на упругость, блеск и ровность. Масло хорошо крепится к тональной основе, поддерживая ее. Таким образом, этот вариант лучше других подходит тем, кто хочет совместить уход за кожей лица и красивый вид, так как это средство выполняет две функции одновременно.

Функционал праймера

Если разделять праймеры по функционалу, то получится, что есть три основных вида этих средств: матирующий, сияющий и корректирующий. Разберемся, что делает каждый из них.

Матирующий праймер убирает жирный некрасивый блеск, что не удается зачастую скрыть. Это вещество взаимодействует с элементами, которые создают этот эффект, с сальными выделениями кожи. Стоит отметить, что препарат безопасен, потому что он не загрязняет при этом поры. Такие средства обычно создаются на основе минералов.

Сияющий праймер может добавить правильного блеска коже. Создаст впечатление ухоженной, красивой гладкой кожи, с мягким и сияющим оттенком лица, свойственным только молодым лицам.

Корректирующий праймер, он же зеленый, не наносится на всю кожу, он работает только с определенными фрагментами лица. Он может скрыть сыпь или красноту. По функционалу он куда ближе к базе, а не к тональному крему.

Подбор праймера

Прежде всего, средство подбирают по типу кожи, поскольку они работают с конкретными недостатками поверхности, а не с общим эффектом. Если кожа жирная, то нужно сузить поры, уменьшив выделение сального вещества. Подойдет и состав с минералами. Они сделают кожу ровнее, уберут красноту и раздражение. Силиконовый праймер тоже подойдет, если нет серьезных дефектов. Для сухой кожи подойдут кремовые и жидкие праймеры, что могут дополнительно увлажнить кожу и скрыть сухость. Для комбинированной кожи подойдут минеральные праймеры, и если нет дефектов, то и силиконовые. Они же подойдут для возрастной кожи, так как увлажнят ее и скроют морщины.

Как наносить праймер

Довольно просто, но лучше держать в голове пару полезных деталей. Итак, сначала кожа очищается, и наносится увлажняющее средство. Это нужно, потому что праймер не всегда справляется с увлажнением на сто процентов. Далее стоит прикинуть, какова текстура праймера и решить, как его стоит наносить. Силиконовый праймер наносится на определенные участки лица, а лосьон на все лицо. Состав наносится пальцами, без дополнительных приспособлений. Как и в случае с кремом, лучше наносить его мягкими движениями от середины лица, двигаясь снизу-вверх, дополнительно подтягивая кожу наверх, а, не направляя вниз.

что это, виды, характеристики, правила применения

Когда речь идет о плоской кровле, согласитесь, что главная задача – надежно ее гидроизолировать. Ведь здесь ввиду минимального уклона вода застаивается больше всего, как и талый снег. Потому и кровельное покрытие выбирают особенное, рассчитанное на противостояние атмосферным явлениям.

Под него просто жизненно надежное гидроизоляционное основание, например, грунтовка, чтобы случайное повреждение кровли в одном месте не привело к потоку внутри дома. Причем наиболее надежным считается состав на основе природного битума, улучшенного при помощи специальных добавок. Сейчас вам и расскажем поподробнее: что такое битумный праймер, что именно он собой представляет и как его использовать.

Давайте начнем с точного определения, чтобы вы никогда не путали праймер с мастикой или герметиком. Речь идет о битумной грунтовке, которая предназначена для предварительной обработки металла, бетона или железобетона. Битумный праймер хорош также в качестве клейкого слоя для мягкой кровли и антикоррозийного покрытия для металлической.

Вот преимущества этого материала:

  • Теплостойкость, до +80°С.
  • Водоотталкивающие и антикоррозийные свойства.
  • Быстрое высыхание и отсутствие липкости.

Если говорить точным техническим языком, по своему составу битумный праймер – это однородный черный раствор нефтяных битумов в органических растворителях.

От других таки битумы отличаются тем, что не содержат никаких неоднородностей или посторонних включений. При этом в битумном праймере нет токсичных растворителей.

Вот небольшой обзор стандартного битумного праймера:

От других видов битумный праймер отличается высокой адгезией, отсутствием неприятной липкости, теплостойкостью, быстрым высыханием и отличными гидроизоляционными качествами. Также битумный праймер обладает ценными водовытесняющими свойствами и возможностью применения в зимнее время.

Что касается крыши, чаще всего сегодня праймер наносят для того, чтобы потом уложить на крышу мастику или битумные рулонные материалы, с целью улучшения гидроизоляционных свойств:

Сферы применения битумной грунтовки

Битумным праймером грунтуют такие поверхности: металл, дерево, бетон, асбоценмент и железобетон.

При помощи этого материала к последующим гидроизоляционным работам готовят:

  • фундаменты;
  • мостовые пролеты;
  • основания плоских кровель;
  • поверхности трубопроводов из металла;
  • подземные конструкции и сооружения.

Если поверхность неровная, пористая и пыльная, тогда ее обрабатывают праймером при помощи щеток и капроновых кистей.

Виды праймеров на основе битума

Современный рынок предлагает сегодня битумный праймер двух видов: концентрированный и готовый к применению. В работе с первым случаем концентрат следует разводить такими органическими растворителями, как бензин, керосин или уайт-спирит. Обычно разводят в таком соотношении: 1 к 1,5 или 2. С готовым праймером ничего делать уже не нужно.

Подбирая подходящий праймер, вы столкнетесь также с такими его видами:

  • Кровельный, который корректирует дефекты основания и готовит его для монтажа кровельных покрытий.
  • Дорожный, для связывания щебня при устройстве дорожного покрытия.
  • Универсальный, для поверхности почти всех видов.

А по своему способу нанесения праймеры сегодня поставляются горячего и холодного применения.

Битумный праймер сегодня изготавливают с такими растворителями, как толуол, бензин, сольвент и уайт-спирит. Вот почему от него исходит такой резкий запах! Кроме того, важно не забывать и о средствах индивидуальной защиты, как перчатки, специальный костюм и очки.

В отличие от праймера, битумная мастика поставляется без органических растворителей и обладает тоже хорошими гидроизоляционными свойствами. Но в дальнейшем будущем праймер уже не будет издавать неприятный аромат, т.к. растворитель в нем улетучится.

На некоторые виды битумного праймера строители любят жаловаться ввиду его резкого и неприятного запаха. Также в процессе работы помните о том, что такой праймер – материал огнеопасный, особенно в жидком виде, и работать с ним нужно осторожно.

Чтобы ничего плохого не произошло, с праймером следует работать только на открытом воздухе или в хорошо вентилируемом помещении.

Кроме того, важно защитить руки и открытые части тела, т.к. праймер просто  впивается в кожу и сложно не отмывается с нее (придется воспользоваться керасином).

Изготовление праймера из битума своими руками

Будьте внимательны, выбирая праймер, т.к. сегодня встречаются и некачественные. Таковые просто не высыхают, совсем, и поверхность остается влажной. По слухам, это происходит из-за того, что еще в заводских условиях такие праймеры разбавляют соляркой, из-за чего те теряют свои свойства.

Так это или нет, мы не можем сказать, но факт остается фактом: некачественная продукция на строительном рынке есть.

К слову, немало людей сегодня делают битумную грунтовку самостоятельно, хотя она и не будет такой однородной и качественной, как заводская. Вот инструкция:

  • Шаг 1. Приготовьте 1 кг битума и 2,5 кг неэтилированого бензина.
  • Шаг 2. Расплавьте битум, пока он не станет жидким, и остудите до температуры 80°С.
  • Шаг 3. Теперь аккуратно добавьте понемногу, небольшими порциями, жидкий битум в бензин. Крайне важно это делать постепенно, чтобы бензин не воспламенился.
  • Шаг 4. Получившуюся смесь процедите через мелкое металлическое сито.

И праймер будет готов к работе.

Более точно рассчитать количество битумного праймера вам поможет знание некоторых нюансов. Так, праймер в горячем объеме всегда расходится в большем объеме, чем холодный. Хотя при этом горячий праймер считается более толковым и практичным.

Также имеет значение то, каким инструментом вы собираетесь пользоваться – кисточкой или валиком, и на какую поверхность будете наносить состав. У валиков – меньший расход материала, а вертикальные стены парапета нуждаются в двух-трех слоях, и каждый из них поочередно должен хорошо высохнуть.

А для горизонтальной поверхности количество слоев каждый раз варьируется, в зависимости от задачи. Например, чтобы приклеить рубероид, достаточно будет одного слоя праймера, а вот для обустройства мастичной кровли – уже два-три слоя. Саму же площадь поверхности вычислить несложно.

Давайте шаг за шагом рассмотрим технологию нанесения праймера и те важные правила работы с ним, которые помогут провести все работы аккуратно.

Подготовка праймера к применению: температура и однородность

Первым делом тщательно перемешайте праймер так, чтобы на его дне растворился весь осадок. Тогда смесь будет однородной и достаточной густоты, и при необходимости ее разбавляют растворителем.

Если же не размешать, тогда сначала слой будет ложиться слишком тонком, а под конец – слишком густо. А должна быть вот такая консистенция:

Праймер готов к работе тогда, когда его температура выше 10°С. Если нужно, поверхность кровли и сам праймер можно подогреть, но не выше 40°С. Не работайте с праймером при температуре меньше -10°С, и в промежутке от -10°С до 0°С праймер придется подогревать на паровой или водяной бане.

Подберите для этой цели герметичную емкость с крышкой. Только будьте крайне осторожны: нельзя, чтобы праймер коснулся открытого огня или пригорел к емкости.

Техника безопасности, о которой стоит помнить

Также помните о том, что у битумного праймера есть и обратная сторона, как возможность испачкать что угодно. Причем обычными средствами пятна не удаляется.

Но выход есть:

  • с инструментов удалите при помощи уайт-спирита;
  • с резины – дизельным топливом;
  • с тканей – такими легкими растворителями, как бензол.

Берегите от загрязнения битумным веществом также открытую кожу и особенно слизистые.

Очистка поверхности и нанесение праймера

По правилам битумный праймер наносят на сухую и чистую поверхность, в два слоя, толщина каждого – по 0,5 мм:

Давайте разберем технологию нанесения праймера более подробно:

  • Шаг 1. Тщательно очистите поверхность крыши от грязи и пыли, для чего вооружитесь щеткой или строительным пылесосом.
  • Шаг 2. Аккуратно откройте банку с праймером (битум сильно пачкается).
  • Шаг 3. Тщательно размешайте праймер дрелью с низким оборотом и удобной насадкой.
  • Шаг 4. Чистым меховым валиком нанесите на основание крыши валиком.
  • Шаг 5. Все углы на крыше и труднодоступные места обработайте кистью.
  • Шаг 5. Дайте хорошо подсохнуть праймеру, желательно до 12 часов.

Само время высыхания зависит от типа праймера, производителя и погодных условий. Например, при температуре в 20°С поверхность полностью высохнет за 12 часов.

А проверить, высох ли праймер, достаточно легко: просто приложите к нему салфетку и проверьте, не осталось ли следов. И чем выше будет температура воздуха, и чем ниже его влажность, тем быстрее праймер высохнет.

К слову, качественная битумная грунтовка радует не только качеством, но и отсутствием проблем в процессе работы с ней. Речь идет о чистых руках, отсутствии запаха и необходимости особых усилий. Такой праймер легко наносится обычным валиком или кисточкой:

А вот пример работы с валиком, достаточно легкое занятие, согласитесь:

Если же праймер используется в качестве клеящего материала для рулонной кровли, то каждый последующий слой накрывают через 3-4 часа после предыдущего. После того, как полотно приклеено, его обязательно прикатывают специальным цилиндрическим катком.

Но с праймером, в отличие от мастики, довольно сложно работать на вертикальных поверхностях. У него еще недостаточна адгезия, а потом битум немного стекает вниз. Хотя предприимчивые строители научились справляться с этой проблемой, удерживая свежий слой на стене обычной полиэтиленовой пленкой.

К слову, если битумный праймер у вас останется, плотно закройте банку крышкой. Качественного праймера для гидроизоляции фундамента, как правило, хватает минимум на 8-10 лет. Но некачественный может огорчить результатом уже в первую снежную зиму, когда сойдет пластом. В хозяйстве он всегда приходится, например, им хорошо защищать от гниения деревянные детали.

Мы раскрыли вам основные особенности применения праймера на основе битума. Остались ли у вас вопросы? Будем рады помочь советом!

Праймер для лица: что это такое?

Праймер для лица – это средство для маскирования видимых недостатков кожного покрова, таких как краснота, увеличенные поры, мимические морщины и неровности кожи. Кроме того, основа для макияжа позволяет тональному средству ложиться намного ровнее, что гарантирует естественный оттенок кожи и свежесть на протяжении дня.

Каждая пятая женщина не покупает праймер только потому, что некоторые дамы заявляют о схожести средства с тональным кремом, которые имеют одно и то же назначение и покупать оба продукта нет смысла. Если разобраться, то база под макияж необходима для скрытия недостатков кожи и защиты ее от воздействия декоративной косметики, а вот тональная основа используется для выравнивания тона лица.

Праймер – это средство для создания основы макияжа, поскольку специальные вещества, находящиеся в составе средства, предотвращают появление излишнего количества кожного сала. Поэтому лицо на протяжении дня выглядит свежо, а декоративная косметика не тускнеет.

Виды праймеров

На сегодняшний день в магазинах косметики представлено большое количество основ под макияж, поэтому чтобы выбрать подходящий вариант, необходимо разобраться во всех тонкостях состава. Перед тем как совершать покупку, определитесь для чего именно вам нужен праймер, поскольку разные средства предназначаются для преодоления определенных недостатков:

Праймер для коррекции по своей консистенции напоминает консиллер, но предназначается такое средство для скрытия неглубоких рубцов, шероховатости и других неровностей кожи. Специально разработанный состав праймера позволяет тщательно замаскировать все недостатки кожи. В зависимости от проблемы, средство выбирают желтых, розовых или зеленых оттенков.
Шелковая база под макияж придает коже особенной шелковистости и нежности, средство обладает питательными и увлажняющими свойствами. Обволакивая кожу, праймер создает эффект невидимой вуали. В своем составе база под макияж содержит аминокислоты, которые помогают восстанавливаться клеткам кожного покрова.
Праймер с эффектом увлажнения подойдет для макияжа зрелым женщинам, поскольку средство выравнивает тон лица, скрывает мимические морщинки, придает коже особой гладкости, а цвет лица делает свежим.

База под макияж с матирующим эффектом, как правило, используется женщинами в жаркое время года. Благодаря специальным компонентам, кожа не выделяет кожное сало через некоторое время, а остается такой же матовой. Используя праймер данного типа, можете быть уверенными, что ваш макияж не расплывется, а будет свежим и натуральным долгое время. Данный праймер подходит для склонной к жирности и чувствительной кожи, базовый крем борется не только с жирным блеском, но и создает антисептическое действие на поверхность кожи.
После нанесения основы для макияжа лицо кажется свежим и отдохнувшим. Праймер наносится только на определенные участки, а вот для вечернего макияжа средство наносят на все лицо. Если вы обладательница манящей светлой кожи, выбирайте холодные оттенки базы, ну а если вы обладательница смуглой кожи – отдайте предпочтение теплым тонам.
Основа под макияж век предназначается для ухода за тонкой и чувствительной кожей вокруг глаз. Небольшое количество средства выравнивает тон и скрывает морщинки, кроме того праймер делает макияж глаз устойчивым, поэтому не нужно будет лишний раз переживать, что осыпались тени.
Минеральные праймеры насыщают кожу необходимыми микроэлементами и придать коже естественное сияние. Средства такого рода ухаживают за кожей лица, не вызывая ее раздражения.

Одними из самых популярных основ под макияж считаются оттеночные средства.

Каждый из представленных цветов скрывает определенный недостаток кожи. Например, зеленый праймер скрывает покраснения, фиолетовый и голубой предназначается для перекрытия желтизны на коже, желтый убирает синие круги под глазами, розовый праймер делает кожу зрительно свежее, белую основу используют для перекрытия пигментных пятен, золотистый оттенок базы предает коже красивый бронзовый отлив загара.

Выбираем правильную основу под макияж

Выбрать хороший праймер не очень легко, как кажется на первый взгляд. Основы под макияж отличаются не только своим предназначением и цветом, но и консистенцией.

Жидкий крем под макияж подойдет только для кожи без недостатков. Праймер предназначается прежде всего для защиты лица от погодных явлений и воздействия косметических продуктов. Праймер напитывает кожу и делает поверхность гладкой, матовой на целый день.
Твердая консистенция праймера указывает на то, что средство предназначается для маскирования значительных дефектов лица, например, рубцов или акне.
Гелеобразный праймер предназначается для кожи, склонной к постоянному появлению кожного жира. Основа прекрасно маскирует все недостатки, не утяжеляя макияж.
Кремовая основа под макияж предназначена для скрытия не очень сильно выраженных покраснений или веснушек. Текстура праймера отличается невесомостью и своей стойкостью, поэтому на протяжении дня девушка может не волноваться за качество макияж.
Праймер в виде пудры быстро справляется с лишним жирным блеском, а легкая текстура ровно ложится на кожу. Средство характеризуется противовоспалительным и подсушивающим эффектом, поэтому такая основа, скорее всего, подходит для жирной или комбинированной кожи.

Немаловажным фактором при выборе любого косметического средства является тип кожи. Для нормальной кожи подойдет кремовая основа, наносить которую следует практически невидимым слоем.

Как известно, сухая кожа требует постоянного увлажнения, поэтому подбирайте праймер в состав которого входят компоненты, насыщающие кожу необходимыми веществами.

Базовый крем под макияж позволяет скрыть шероховатость кожи, мимические морщины и выровнить тон лица. Девушкам, имеющим пересушенную кожу, лучше вовсе отказаться от применения праймеров на основе силикона.

Для кожи с повышенным отделением жира, важно, чтоб базовый крем содержал матирующие компоненты.

Косметический продукт, обладающий достойным качеством, позволяет регулировать выделения подкожного сала, скроет слишком выделенные поры и сделает цвет лица ровным.

Девушкам со слишком чувствительной кожей рекомендуется тщательно подбирать косметические средства для ухода за лицом. Чтоб на коже не появилось покраснений, выбирайте базу для макияжа, в основе которой преобладает вода. Помните, что праймеры с добавлением силикона только навредят людям с чувствительной кожей.

Выбирая праймер, не забывайте учитывать тот факт, что для дневного макияжа предпочтительнее выбирать легкие текстуры, а вот уже для создания вечернего мейкапа выбирайте базовые средства с плотной текстурой. Для создания непревзойденного образа используйте минимальное количество средства.

Искусство нанесения праймера

Неправильно нанесенный праймер испортит макияж и настроение, в том числе. Поэтому важно научиться создавать не просто красивый, но и стойкий макияж.

Первым делом очистите кожу, если этого не сделать, все косметические продукты скатаются в один неровный слой.
Следующим шагом станет увлажнение кожи. Для этих целей вы можете использовать повседневный крем, но не забудьте подождать некоторое время, чтоб средство впиталось. Если вы нанесли слишком много крема, уберите излишки, легонько промокнув лицо бумажным полотенцем.
Далее нанесите пару капель праймера на кожу и равномерно распределите средство при помощи специальной кисти. Для холодного времени года выбирайте основу под макияж, которая защитит кожу от переохлаждения, ну а для жаркого периода средство должно обладать SPF защитой.

Помните, что для создания ровного тона лица достаточно пару маленьких капелек средства (если это жидкий праймер). Растушевывать базу под макияж необходимо плавными движениями, начиная ото лба и двигаясь по массажным линиям. Особенно тщательно необходимо прорабатывать проблемные зоны лица, например, морщины, увеличенные поры, красные следы и т.д.

Если у вас проблемная кожа, склонная к выделению излишнего кожного жира, всегда начинайте наносить косметический продукт с Т-образной зоны, поскольку этот участок является самым проблемным. Если на протяжении дня все-таки кожный жир выступил, не стоит маскировать его дополнительным слоем тонального крема или пудры, поскольку это только ухудшит ситуацию. Чтоб не делать весь макияж заново, воспользуйтесь матирующими салфетками, промокните пару раз специальной салфеточкой проблемную зону, чтоб избавиться от жирного блеска.

Небольшие секреты совершенного тона лица

Каждая женщина мечтает иметь идеальный тон лица, не прилагая при этом особых усилий. И это возможно, если знать несколько секретов нанесения базы под макияж:

Для нанесения праймера лучше всего пользоваться специальной кистью, предназначенной для равномерного нанесения средства.
Наносите праймер похлопывающими движениями на кожу лица.
Всегда предварительно очищайте кожу, а после нанесения крема, подождите некоторое время, чтоб он впитался.

Итак, для создания идеального макияжа, праймер необходимая вещь в косметичке каждой девушки. При умелом выборе и пользовании, вы всегда будете неотразимы.

Что такое олиго?

Выберите страну / регион *

Выберите страну / regionUnited StatesCanadaAfghanistanAlbaniaAlgeriaAmerican SamoaAndorraAngolaAnguillaAntarcticaAntigua и BarbudaArgentinaArmeniaArubaAustraliaAustriaAzerbaijanBahamasBahrainBangladeshBarbadosBelarusBelgiumBelizeBeninBermudaBhutanBoliviaBosnia и HerzegovinaBotswanaBouvet IslandBrazilBritish Индийского океана TerritoryBrunei DarussalamBulgariaBurkina FasoBurundiCambodiaCameroonCape VerdeCayman IslandsCentral африканского RepublicChadChileChinaChristmas IslandCocos (Килинг) IslandsColombiaComorosCongoCongo, Демократической Республика ofCook IslandsCosta RicaCote D’IvoireCroatiaCubaCyprusCzech RepublicDenmarkDjiboutiDominicaDominican RepublicEast TimorEcuadorEgyptEl SalvadorEquatorial GuineaEritreaEstoniaEthiopiaFalkland остров (Мальвинские острова)Фарерские островаФиджиФинляндияПремьер Югославская Республика МакедонияФранцияФранцузская ГвианаФранцузская ПолинезияФранцузские Южные ТерриторииГабонГамбияГрузияГерманияГанаГибралтарГрецияГренландияГренадаГваделупаГуамГватемалаГуин eaGuinea-BissauGuyanaHaitiHeard и McDonald IslandsHoly Престол (Ватикан) HondurasHong KongHungaryIcelandIndiaIndonesiaIran (Исламская Республика) IraqIrelandIsraelItalyJamaicaJapanJordanKazakstanKenyaKiribatiKorea, Корейские Народно-Демократической RepKorea, Республика ofKuwaitKyrgyzstanLao Народный Демократической RepLatviaLebanonLesothoLiberiaLibyan Arab JamahiriyaLiechtensteinLithuaniaLuxembourgMacauMadagascarMalawiMalaysiaMaldivesMaliMaltaMarshall IslandsMartiniqueMauritaniaMauritiusMayotteMexicoMicronesia, Федеративные StatesMoldova, Республика ofMonacoMongoliaMontserratMoroccoMozambiqueMyanmarNamibiaNauruNepalNetherlandsNetherlands AntillesNew CaledoniaNew ZealandNicaraguaNigerNigeriaNiueNorfolk IslandNorthern Mariana IslandsNorwayOmanPakistanPalauPanamaPapua Нового GuineaParaguayPeruPhilippinesPitcairnPolandPortugalPuerto RicoQatarReunionRomaniaRussian FederationRwandaSaint HelenaSaint Киттс и НевисСент-ЛюсияСент-Пьер и МикелонСамоаСан-МариноСао-Томе и ПринсипиСаудовская АравияСенегалСейшельские острова ierra LeoneSingaporeSlovakiaSloveniaSolomon IslandsSomaliaSouth AfricaSpainSri LankaSth Georgia & Sth Sandwich Институт социальных Винсент и GrenadinesSudanSurinameSvalbard и Ян MayenSwazilandSwedenSwitzerlandSyrian Arab RepublicTaiwan, провинция ChinaTajikistanTanzania, Объединенная Республика ofThailandTogoTokelauTongaTrinidad и TobagoTunisiaTurkeyTurkmenistanTurks и Кайкос IslandsTuvaluUgandaUkraineUnited Арабские EmiratesUnited KingdomUruguayUS Малые отдаленные IslandsUzbekistanVanuatuVenezuelaVietnamVirgin острова (Британские) Виргинские острова (U. S.)Острова Уоллис и ФутунаЗападная СахараЙеменЮгославияЗамбияЗимбабве

Выбор праймеров для секвенирования

Выбор праймеров для секвенирования
Последнее обновление: 15 октября 2012 г.

Стандартные грунтовки

Мы поставляем следующие стандартные праймеры (большинство 4 мкМ):
  • M13для 5′ GTAAAACGACGGCCAGT 3′
  • M13rev 5′ CACACAGGAAACAGCTATGACCAT 3′
  • 1233rev 5′ AGCGGATAACAATTTCACACAGGA 3′
  • T7long 5′ GTAATACGACTCACTATAGGGC 3′
  • T7короткий 5′ TAATACGACTCACTATAGGG 3′
  • T7term 5′ GCTAGTTATTGCTCAGCGG 3′
  • T3 5′ ААТТААКККТАКТАААГГГА 3′
  • SP6 5′ ATTTAGGTGACACTATAG 3′
  • SP6Long 5′ ATTTAGGTGACACTATAGAATAC 3′
  • BGHrev 5′ TAGAAGGCACAGTCGAGG 3′
  • pGEXFor 5′ CTGGCAAGCCACGTTTGGTG 3′
  • pGEXRev 5′ GGAGCTGCATGTGTCAGAGG 3′
  • CMVf 5′ CGCAAATGGGCGGTAGGCGTG 3′
  • pQESeqF 5′ GGCGTATCACGAGGCCCTTTCG 3′
  • pQESeqR 5′ CATTACTGGATCTATCAACAGG 3′
  • полиТ-Г 5′ TTTTTTTTTTTTTTTTTTTTTTTTTTTG 3′
  • полиТ-С 5′ TTTTTTTTTTTTTTTTTTTTTTTTTC 3′
  • полиТ-А 5′ TTTTTTTTTTTTTTTTTTTTTTTTTTTA 3′
  • полиТ(ACG) 5′ TTTTTTTTTTTTTTTTTTTTTTTTTA/C/G 3′
  • полиA-G 5′ AAAAAAAAAAAAAAAAAAAAAAAAAAAG 3′
  • полиА-С 5′ AAAAAAAAAAAAAAAAAAAAAAAAAAAC 3′
  • полиА-Т 5′ AAAAAAAAAAAAAAAAAAAAAAAAAAAT 3′
  • полиА(CGT) 5′ AAAAAAAAAAAAAAAAAAAAAAAAAC/G/T 3′

Для больших шаблонов, таких как BAC, PAC и космиды, которые могут иметь более высокие уровни примесей, мы рекомендуем использовать грунтовку SP6long вместо стандартного праймера SP6, который имеет незначительно низкую Tm. Праймер SP6long состоит из четырех оснований. длиннее (поэтому проверьте совместимость с вашими векторами), но хорошо подходит для больших шаблонов, когда более короткий Праймер SP6 не работает.

Рекомендации по дизайну грунтовки

Одним из наиболее важных факторов успешного автоматизированного секвенирования ДНК является правильное дизайн грунтовки. Важно, чтобы грунтовка обладала следующими характеристиками:
  • Температура плавления (Tm) в диапазоне от 50°С до 65°С
  • Отсутствие способности к димеризации
  • Отсутствие образования значительной шпильки (>3 п.н.)
  • Отсутствие мест вторичной затравки
  • Специфическое связывание на 3′-конце от низкого до умеренного (избегайте высокого содержания GC во избежание неправильного запуска)
Праймеры, разработанные в соответствии с этими критериями, обычно имеют длину от 18 до 30 оснований. и иметь %GC от 40 до 60.Старайтесь избегать использования праймеров с Tm выше 65-70°С, особенно на высоких GC. шаблоны, так как это может привести к вторичным артефактам прайминга и зашумленным последовательностям. Мы настоятельно рекомендуем использовать компьютерное программное обеспечение для разработки праймеров с этими характеристики. Примеры такого программного обеспечения: LaserGene (DNAStar), Oligo (National Biosciences, Inc.), MacVector (Kodak/IBI) и пакет GCG. Кроме того, есть веб-сайт доступны для разработки праймеров для ПЦР с помощью программы Primer.Вместо программного обеспечения для грубой оценки Tm можно использовать следующее уравнение:
    Tm = 59,9 + 0,41*(%GC) - 600/длина
 
При разработке праймера на основе существующих данных секвенирования выберите сайт праймирования, размер которого превышает 50 нуклеотидов от положения, в котором требуется новая последовательность. Избегайте разработки праймеров с использованием области последовательности более низкого качества, такие как области за пределами разрешения одного пика хроматограммы (обычно 600-700 оснований). Избегайте праймеров там, где альтернативные сайты праймеров присутствуют с более чем 90% идентичностью с основным сайтом или совпадают более чем с семью последовательные нуклеотиды на 3′-конце.

Наконец, имейте в виду, что ни один набор рекомендаций не всегда точно предскажет успех праймера. Некоторые праймеры могут не работать без видимых причин, а праймеры, которые кажутся плохими кандидатами, могут работать хорошо.

ДНК праймеров – обзор

4 Протокол

Эта глава не является стандартным протоколом, а перечисляет распространенные проблемы с ПЦР, причины, по которым они могут возникнуть, и шаги, которые можно предпринять для предотвращения этих проблем в будущем.Чаще всего после проведения ПЦР агарозный гель прогоняют с продуктом ПЦР вместе с лестницей ДНК для проверки размера продукта. Сразу бросаются в глаза две проблемы: во-первых, нет продукта ПЦР, а во-вторых, продукт(ы) ПЦР есть, но не того размера. В Таблице 22.1 приведены некоторые причины и возможные способы устранения неполадок, связанных с отсутствием производства продукта ПЦР. В Таблице 22.2 приведены некоторые причины и возможные решения, когда есть продукт ПЦР, но он имеет неправильный размер.

Таблица 22.1. Устранение неисправностей Отсутствие продукта ПЦР, увиденного на агарозном GEL

Грунтовки не работает

PCR возможные причины исправлений
без продукта сформированы

проблема с реагентами

Повторите эксперимент, как реагент, возможно, был непреднамеренно оставлен на

Убедитесь, что реагенты были полностью оттаиваются и тщательно смешаны

. Попробуйте новый флакон DNTPS, как они могут быть повреждены повторным замораживанием Cycles

Использование другой полимеразы

Попробуйте с помощью добавок, таких как DMSO или GLYCEROL

    3 •

    Низкое качество матричной ДНК

9 0105

ИСПОЛЬЗОВАНИЕ Нанодолрофотометр для проверки количества и качества шаблона ДНК

Ремик шаблон ДНК. Старые акции могут ухудшаться, особенно для геномной ДНК

Настройка ряд реакций с различными количествами шаблона (от 10 до 200 NG ДНК)

Убедитесь, что праймеры разведены до правильной концентрации

Убедитесь, что последовательность праймера соответствует вашим ожиданиям.Опечатки часты!

Увеличить концентрация грунтовки

RedeSign Комплекты

ингибиторы ПЦР присутствуют в шаблоне DNA

Продемонстрировать, что контрольный ген или другая последовательность ДНК могут быть эффективно амплифицированы с использованием той же матричной ДНК. Если это может, есть еще одна проблема с реакцией ПЦР

    9

Эта проблема с настройками на термическом велосипеде

Проверьте вексель — это температура и раз, как вы ожидаете?

Изменение температуры отжига. Найдите оптимальную температуру с помощью градиентного амплификатора и проверьте диапазон от самой низкой температуры грунтовки T m до температуры на 10 °C ниже T m

Попробуйте реакцию в другом амплификаторе. Калибровка того, который вы используете, может быть выключен

Шаблон ДНК — GC-Rich

Использование полимеразового буфера, предназначенного для богатых GC шаблоны.Протестировать весь спектр добавки (например, расплав ГХ)

Таблица 22.2. Устранение неисправностей PCR Продукты, которые либо слишком длинные или слишком короткие

Проблема PCR возможные причины Исправления
Продукт неправильного размера

Cross-загрязнение

Используйте следующий порядок при настройке реакций: фактические образцы, положительные контроли, а затем отрицательные контроли

Используйте наконечники пипеток с аэрозольным барьером

С образцами до и после амплификации следует работать в физически разделенных областях. Подготовьте отдельный лабораторный стол и набор пипеток для работы с гелями.

Длинные неспецифические продукты

Уменьшение нанесения отжига и / или расширения

Уменьшение температуры расширения до 62-68 ° C

Увеличение температуры отжига.

Увеличение MgCl 2 Концентрация до 3-4,5 мм, при сохранении постоянной концентрации DNTP

Использование меньшей грунтовки, ДНК-шаблон и / или полимераза

Если ни один из вышеперечисленных способов не работает, выполните BLAST праймера для повторяющихся последовательностей и попробуйте разработать новый праймер(ы). размера одного грунта или обоих вместе, которые образуются при отжиге грунта с самим собой или с другим грунтом

Увеличьте температуру и/или время отжига. Попытаться найти оптимальную температуру отжига с помощью градиентной ПЦР-машины

Один или оба праймера отжигают на нецелевом участке матрицы, что приводит к очень короткому продукту ПЦР

3

3

Увеличение времени расширения и / или температура до 74-78 ° C

TitRate MGCL 2 Концентрация до 3-4,5 мм, при сохранении постоянной концентрации DNTP

Использование меньше грунтовки или Taq Polymerase

Попробуйте «горячее начало» полимеразу вместо стандартной полимеразы

Увеличение количества ДНК-шаблона

Если ни одно из вышеперечисленных действий не работает, ВЗЛОМИТЕ праймер для повторяющихся последовательностей и попробуйте разработать новый праймер(ы)

Поскольку в ПЦР используется пять основных реагентов, вы можете изменить любой из них, чтобы оптимизировать реакцию для вашего конкретного интересующего гена и продукта. Предпочтительно изменять только один аспект реакции за раз. Ниже приведены примеры того, как каждый реагент, MgCl 2 , ДНК-полимераза Taq, праймеры, dNTP и ДНК-матрица, могут вызвать проблемы в ПЦР, и допустимые диапазоны концентраций для каждого реагента.

MgCl 2 : Магний играет несколько ролей в ПЦР: это важный кофактор для термостабильных ДНК-полимераз, он стабилизирует двухцепочечную ДНК и поднимает T m .Недостаточная или низкая концентрация Mg 2+ требует более строгого спаривания оснований при отжиге праймеров и ДНК и может привести к небольшому выходу продукта ПЦР или его отсутствию. При избытке ионов Mg 2+ может наблюдаться повышенный выход неспецифических продуктов и снижаться надежность ДНК-полимераз, что способствует неправильному включению нуклеотидов и образованию пятен на геле. Поскольку dNTP связывают ионы Mg 2+ , любое изменение концентрации dNTP потребует дополнительных изменений концентрации MgCl 2 . Обычно оптимальная концентрация MgCl 2 составляет от 1 до 4 мМ.

ДНК-полимераза Taq : Низкий уровень Taq-полимеразы может вызвать неполное удлинение праймера или несвоевременное прекращение синтеза продукта ПЦР на этапе удлинения. Слишком много полимеразы приведет к чрезмерному фону нежелательных фрагментов ДНК, которые будут выглядеть как мазок на геле. Заметно избыточное количество полимеразы может привести к полному провалу реакции без образования продукта.Концентрация полимеразы 1 единица на 25 мкл реакционной смеси достаточна для получения чистого продукта ПЦР.

Праймеры : Низкая концентрация праймера обычно приводит к получению более чистого продукта, однако повышение концентрации праймера не приводит к соответствующему увеличению количества образующегося продукта. Использование повышенных концентраций праймеров может привести к созданию димеров праймеров, неспецифическому связыванию праймеров и образованию нежелательных продуктов ПЦР. И наоборот, для амплификации коротких последовательностей-мишеней, таких как 100 пар оснований, требуется большее количество молекул продукта ПЦР для получения определенного количества амплифицированной ДНК (в нанограммах).В этом случае более высокая концентрация праймера может быть полезной. Предлагаемая концентрация праймера составляет от 0,1 до 1 мкМ каждого праймера. Базовый состав праймеров и сайты праймеров также могут значительно повлиять на эффективность ПЦР, см. главу «Пояснение» к главе «ПЦР — дизайн праймера».

dNTPs : Субоптимальная концентрация нуклеотидов может привести к неполному удлинению праймера или преждевременному прекращению синтеза в какой-то момент на этапе удлинения. Чрезмерные концентрации dNTP могут ингибировать ПЦР, предотвращая образование продукта.Обычная концентрация dNTP составляет от 40 до 200 мкМ для каждого из четырех dNTP. Для амплификации более длинных фрагментов ДНК может потребоваться более высокая концентрация dNTP.

Матрица ДНК : Концентрация ДНК-матрицы должна быть сбалансирована с количеством циклов реакции. Когда общее количество ДНК чрезвычайно мало, возрастает вероятность потери, загрязнения ДНК примесями и/или деградации. Использование слишком большого количества ДНК может привести к нецелевому отжигу праймеров, а также к плохому синтезу ДНК из-за затрудненной диффузии полимеразы.Однако уменьшение числа циклов может помочь решить эти проблемы. Загрязнение может происходить из маловероятных источников, таких как пыль, плавающая в воздухе, или частицы кожи или волос с вашего тела, которые могут нести как ДНК, так и нуклеазы, разлагающие ДНК. Чтобы предотвратить это, автоклавируйте пробирки, наденьте перчатки и очистите рабочее пространство, используя окисляющее вещество (например, 6% H 2 O 2 ), 100% этанол или салфетку для обеззараживания поверхности (например, DNA AWAY®). , Молекулярные биопродукты).

Слабую амплификацию мишени можно улучшить следующими способами:

Увеличение количества праймеров, матрицы ДНК и/или полимеразы.

Проверка последовательностей праймеров на наличие несовпадений и/или увеличение длины праймеров на пять нуклеотидов (см. также Пояснительную главу: ПЦР — Дизайн праймеров).

Увеличение времени отжига или уменьшение температуры отжига.

Увеличение количества циклов.

Попробуйте добавить 5% (по объему, конечная концентрация) ДМСО или глицерин.

Извлечение слабого продукта ПЦР из агарозного геля с использованием набора для очистки геля ДНК и использование его в качестве матрицы в новой реакции.

Неспецифическую полосовую амплификацию можно зафиксировать:

Повторение реакции с отрицательным контролем, например с водой. Неспецифические полосы, скорее всего, связаны с загрязнением чужеродной ДНК. Если это проблема, используйте новые запасы для всех реагентов. Кроме того, не забывайте всегда использовать автоклавированные пробирки для ПЦР и надевайте перчатки.

Использование меньшего количества матрицы ДНК.

Увеличение времени отжига, если неспецифические продукты короче целевого.Если они длиннее вашей цели, уменьшите время отжига.

Повышение температуры отжига.

Изменение дизайна праймера (праймеров) для увеличения длины на его 3′-конце, поскольку дополнительные полосы могут быть из последовательностей, аналогичных вашей мишени. Увеличение длины 3′-праймера за счет добавления дополнительных совпадающих пар оснований сделает праймер более специфичным для вашей мишени, потому что правильное связывание последовательности будет улучшено, а удлинение неспецифических последовательностей будет заблокировано.При попытке устранить аберрантные полосы обычно не рекомендуется увеличивать длину праймера на его 5′-конце, потому что это повысит его способность отжигаться с нецелевыми последовательностями. В некоторых случаях более короткие праймеры будут работать лучше, потому что они не образуют пары оснований с нецелевыми последовательностями.

РНК-праймер в репликации ДНК: определение, функция и последовательность — видео и стенограмма урока

Обзор репликации ДНК

Теперь, когда мы понимаем, как комплементарность работает в ДНК и РНК, мы можем начать понимать, как наши клетки создают копии ДНК, когда это необходимо.Наши клетки стареют и постоянно нуждаются в замене новыми клетками. Чтобы это произошло, клетка должна сначала сделать копию ДНК, прежде чем в результате клеточного деления будет произведена новая. Это гарантирует, что новая клетка будет иметь полный набор ДНК, присутствующий в любой другой клетке. Репликация ДНК — это термин, обозначающий процесс, в ходе которого копируется наша ДНК до образования новой клетки. Во время этого процесса ДНК должна быть сначала размотана или расстегнута из комплементарной цепи. Затем каждая цепь используется в качестве шаблона для создания нового комплементарного фрагмента ДНК. На приведенном здесь рисунке красные нити ДНК представляют исходные фрагменты ДНК, а розовые нити обозначают новые комплементарные фрагменты ДНК, построенные во время репликации.

В конце репликации каждый набор ДНК состоит из одной исходной цепи и одной новой цепи.

Роль РНК-праймеров

Во время репликации ДНК две части ДНК разделяются и используются для создания новых комплементарных цепей ДНК. ДНК-полимераза — это фермент, отвечающий за сборку новых цепей ДНК. Однако ДНК-полимераза может связываться с исходной ДНК только при наличии второй цепи. Это представляет собой проблему, поскольку исходные цепи были отделены друг от друга, что привело к образованию отдельных цепей ДНК. Таким образом, прежде чем ДНК-полимераза сможет начать синтезировать новую ДНК, необходимо создать праймер . В общем случае праймер представляет собой короткий сегмент ДНК или РНК, необходимый для синтеза ДНК.

При репликации ДНК праймер представляет собой комплементарную цепь РНК, показанную синим цветом, которая связывается с исходной цепью ДНК, показанной красным.Создав небольшой сегмент комплементарных нуклеотидов, ДНК-полимераза теперь имеет сайт, с которым она может связываться. После того, как РНК-праймер будет создан, ДНК-полимераза свяжется с ним и начнет создавать новую цепь ДНК, добавляя к праймеру комплементарные нуклеотиды. На рисунке показаны исходная ДНК, праймеры РНК и новая комплементарная ДНК.

После того, как ДНК-полимераза закончит построение новой ДНК, в дело вступит другой фермент и удалит РНК-праймеры, прежде чем заменить их комплементарными нуклеотидами ДНК.В конце этого процесса остаются только две копии, в которых отсутствует какая-либо РНК.

Итоги урока

Давайте повторим. И ДНК, и РНК состоят из определенных нуклеотидов , которые действуют как строительные блоки генетического кода. Каждый нуклеотид имеет еще 90 660 комплементарных 90 661 нуклеотидов, с которыми он спаривается. В ДНК аденин сочетается с тимином, а гуанин — с цитозином. В РНК аденин сочетается с урацилом, а гуанин — с цитозином. Во время репликации ДНК две исходные комплементарные нити ДНК разделяются, и каждая используется в качестве матрицы для создания новой ДНК. ДНК-полимераза представляет собой фермент, отвечающий за построение новой комплементарной ДНК. Однако для этого требуется наличие РНК праймера , который служит отправной точкой для репликации. Каждый праймер представляет собой короткий фрагмент РНК, комплементарный исходной цепи ДНК. Без праймера ДНК-полимераза не может копировать ДНК. Короче говоря, РНК-праймеры служат стартовым сайтом для ДНК-полимеразы, когда ДНК необходимо скопировать. Как только ДНК скопирована, праймеры больше не нужны и поэтому удаляются.

Сравнение ДНК-праймеров и РНК-праймеров:

Праймеры в молекулярной биологии используются в качестве отправной точки в синтезе ДНК, in vitro , а также in vivo .

ДНК-праймер используется в ПЦР-амплификации, тогда как РНК-праймер является основным компонентом репликации.

В Интернете доступно множество материалов по обеим темам, но, сравнивая праймер ДНК с праймером РНК, мы можем понять это очень хорошо.

Но перед этим, 

Начнем с основ, 

Репликация ДНК необходима для копирования генетического материала, унаследованного в дочерних клетках.Процесс репликации является ферментозависимой каталитической реакцией, в которой для этого используется множество белков.

С другой стороны, 

ПЦР также используется для синтеза ДНК, но этот процесс зависит от температуры. Он амплифицирует миллионы копий ДНК в целях исследования.

Основной целью обоих процессов является синтез новой ДНК.

Оба процесса требовали нуклеотидов, ДНК-полимеразы и праймера в качестве основных ингредиентов для копирования ДНК.

Прочтите статьи по теме:

Однако для амплификации с помощью ПЦР также требуется несколько других химических веществ и ингредиентов.

ДНК-полимераза выполняет одну из важных функций в синтезе ДНК, добавляя нуклеотиды к растущей полинуклеотидной цепи.

Интересно, что полимераза, используемая в ПЦР, не является обычной, это особый тип фермента, устойчивый к температуре, называемый ДНК-полимеразой Taq.

Работает даже при более высокой температуре. Узнайте больше о ДНК-полимеразе Taq: Функция ДНК-полимеразы Taq в ПЦР

Но для удлинения полинуклеотидной цепи каждой полимеразе требуется короткий участок одноцепочечной нуклеиновой кислоты, который обеспечивает свободную 3′-группу ОН.

Функционально ДНК-полимераза отличается от РНК-полимеразы. Поскольку ДНК-полимеразе требовалась отправная точка, свободный конец 3’ОН, с которого она начинает полимеризацию, образуя фосфодиэфирную связь.

В ПЦР свободная 3’-ОН группа обеспечивается праймером ДНК.

В настоящей статье мы сравниваем эти два различных типа праймеров, используемых в синтезе ДНК.

Прежде всего, РНК-праймер не имеет значения для ПЦР-амплификации. Однако это необходимо для процесса репликации.

РНК-праймер представляет собой короткий участок нуклеиновой кислоты, состоящий из одноцепочечной молекулы РНК.

РНК-полимераза, называемая ДНК-примазой, синтезирует короткий участок одноцепочечной молекулы РНК для начала репликации.

Очень важно, чтобы ДНК-полимераза начала свою каталитическую активность.

Одноцепочечный РНК-праймер обеспечивает свободную 3’-группу ОН, необходимую для ДНК-полимеразы.См. изображение,

Праймеры РНК бывают двух типов, используемых в репликации. Один, который запускает репликацию ДНК и имеет длину примерно от 10 до 18 нуклеотидов на ведущей цепи.

В то время как другие используются для синтеза фрагментов Окадзаки, и они имеют длину от 8 до 10 нуклеотидов на отстающей цепи.

Почему репликация зависит от праймера РНК, а не праймера ДНК?

Ответ здесь,

Единственная РНК-полимераза доступна для синтеза одноцепочечной РНК, поэтому в репликации используется не ДНК, а РНК.

И, наконец, за счет экзонуклеазной активности ДНК-полимеразы удаляются РНК-праймеры, одновременно полимераза заполняет пробел комплементарными нуклеотидами и запечатывает ДНК-лигазой.

Для этого ДНК-полимераза отслеживает и находит праймер РНК, который на самом деле не является частью нашей цепи ДНК.

(ДНК-лигаза заполняет промежуток между соседними нуклеотидами, образуя фосфодиэфирную связь.)

Экзонуклеазная активность ДНК-полимеразы от 3’ до 5’ удаляет его.

Примечание: для репликации ДНК используется только один тип РНК-праймера.

Интересный факт:

ДНК-полимераза может удлинять полинуклеотидную цепь, но не может синтезировать ее напрямую (ей нужен свободный 3’-конец).

Это может сделать только РНК-полимераза, поэтому в репликации используется РНК-праймер.

Существует разница между синтезом и удлинением нуклеотидных цепей, см. изображение ниже, 

Подобно праймеру для РНК, праймеры для ДНК также используются для синтеза ДНК.

Искусственно синтезированные ДНК-праймеры используются для амплификации ДНК в ходе реакции ПЦР.

Это одноцепочечная молекула ДНК длиной от 12 до 25 нуклеотидов.

Здесь праймеры для РНК не могут работать эффективно, потому что они менее стабильны, чем праймеры для ДНК.

В частности, пара праймеров ДНК, один для смысловой цепи ДНК, называемый прямым праймером, и один для антисмысловой цепи ДНК, называемый обратным праймером, используется для амплификации двухцепочечной ДНК.

И прямой, и обратный праймер связываются таким образом, что ДНК-полимераза Taq добавляет нуклеотиды внутрь. См. изображение:

Критерии выбора ДНК-праймера:

Мы рассмотрели целую статью о том, как разрабатывать ДНК-праймеры для ПЦР. прочтите это здесь: руководство по разработке праймеров для ПЦР.

В целом ДНК-праймер, используемый в ПЦР, должен обладать следующими свойствами:

  • Длина от 12 до 20 нуклеотидов (для нормальной ПЦР)
  • Менее или от 45 до 50% содержания GC
  • Меньше способности образовывать шпильки
  • Температура отжига от 55 до 65°C

Примечание:

Мы используем ДНК-праймеры только для целей амплификации, поэтому нет необходимости в корректуре или экзонуклеазной активности.

Праймеры ДНК более стабильны, чем праймеры РНК, даже они не могут разлагаться при более высокой температуре.

Полимераза…

Основная функция праймера — обеспечить соединение или субстрат для работы ДНК-полимеразы и проведения полимеризации.

Хотя полимеразы, используемые при репликации, а также при амплификации, различаются.

Используемая при амплификации полимераза стабильна при более высокой температуре и не обладает экзонуклеазной активностью.

В то время как полимераза, используемая в репликации, не может работать при более высокой температуре и обладает 3’-5’- и 5’-3’-экзонуклеазной активностью.

Экзонуклеазная активность необходима для корректировки всей последовательности после репликации и удаления всех и каждого несовпадающего нуклеотида из вновь синтезированной цепи ДНК.

Смотрите изображение корректуры:

Быстрый резюме между РНК Грунтовка и ДНК Грунтовка:

1
    0
РНК Грунтовки
, используемые в ДНК репликации ( in vivo ) Используется для амплификации ДНК во время ПЦР ( in vitro )
Полинуклеотидная цепь из 10–12 олигонуклеотидов Полинуклеотидная цепь из 12–22 олигонуклеотидов
Стабильна при более высокой температуре Нестабильна при более высокой температуре 9010 Нестабильна при более высокой температуре 9010
Удалены после завершения репликации по экзонуклеазной активности остается частью вновь синтезированной ДНК,
Синтезированная ДНК Primase Синтезированная искусственно
Одной молекулы одноцепочечной РНК используется Пара одноцепочечной ДНК, один прямой праймер и один обратный праймер используется для двух разных одноцепочечных мишеней.
Аденин, гуанин, цитозин и урацил присутствуют в праймере РНК  Аденин, гуанин, цитозин и тимин присутствуют в праймере ДНК , Applications And Branches 

Праймеры являются очень важным компонентом в молекулярно-генетических инструментах, таких как ПЦР или секвенирование ДНК. Инструменты разработки праймеров, такие как Primer 3, помогают исследователям эффективно разрабатывать праймеры для проведения ПЦР.

Ознакомьтесь с нашим руководством по разработке праймера для ПЦР.

Дизайн грунтовки

Люди используют два основных типа праймеров:

  1. Те, которые амплифицируют ДНК
  2. Модифицирующие ДНК

 

Мы сосредоточимся на первом. Мы будем использовать белок ApoE в качестве модели. Мутации в нем являются сильным генетическим маркером болезни Альцгеймера. Мутации в этом гене происходят в аминокислотах 112 и 158. Наша цель будет состоять в том, чтобы амплифицировать этот ген и отправить его на секвенирование. Сначала мы создадим праймеры для всего гена, а затем только для важной области.

 

Сначала найдите последовательность гена, который вы хотите амплифицировать или модифицировать. Отличным местом для поиска является NCBI (http://www.ncbi.nlm.nih.gov/). Я провел поиск и нашел последовательность мРНК гена ApoE человека (http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1). У человека около 3,2 миллиарда оснований ДНК, а это означает, что наши праймеры, вероятно, должны быть как минимум такими же сложными. Поскольку в ДНК 4 основания, сложность равна 4 степени длины.ДНК из 16 пар оснований встречается примерно 1 из 4,3 миллиардов раз(416). Обычно праймеры имеют длину от 15 до 21 пары оснований.

 

Сначала нам нужно понять, как копируется ДНК. ДНК амплифицируется от 3’-конца (произносится как Three Prime) до 5’-конца (произносится как Five Prime) копируемой цепи. Говорят, что усиление идет в направлении от 5’ к 3’.

 

Прямой праймер прост и представляет собой праймер, который находится на нижней пряди на 3′-стороне. Обратный праймер более сложен и связывается с верхней цепью на 3′-стороне.

 

 

Давайте сначала сделаем пример

Вот наша ДНК:

5’ — АТГАГГТТТГКАГГГ — 3’

       | | | | | | | | | | | | | | |

3’ — TACTCCAAACGTCGC — 5’

 

давайте сделаем гипотетические праймеры для коротких фрагментов ДНК, каждый из которых состоит из 4 оснований.

 

Прямые праймеры должны связываться с 3’-концом нижней нити, поэтому они идентичны верхней нити! Это означает, что нашим гипотетическим предварительным праймером будет ATGA.Поскольку праймеры читаются и создаются людьми, наш обратный праймер нужно писать от начала до конца. Это называется «обратным дополнением» верхней нити. 4 основания, которые связываются с 3’ верхней нитью, представляют собой TCGC. Но помните, что букварь начинается с 3′-конца, поэтому его следует читать как CGCT. Это обратное дополнение, противоположное верхней нити.

 

Глядя на последовательность ApoE, попробуйте сделать прямой и обратный праймеры из 20 оснований. Ответы ниже. http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

         

 

 

 

 

 

 

ApoE forward Primer:  cagcggatccttgatgctgc

Обратный праймер ApoE: aagcaccaagttcagggtgt

 

 

Мы можем использовать эти праймеры для амплификации ДНК, извлеченной из вас.Очистите его и отправьте на секвенирование. Но… .. считывания секвенирования, даже хорошие, обычно имеют длину всего около 1000 оснований, а ген > 7000 оснований.

 

Праймеры не нужно создавать только в конце ДНК, вы можете создавать их где угодно для амплификации ДНК. Теперь давайте усилим область от 112 до 158, чтобы получить более разумную последовательность.

 

Сначала давайте переведем ДНК, чтобы выяснить, где в ДНК расположены эти аминокислоты, используя http://web.expasy.org/translate/ Выберите «Включить последовательность нуклеотидов». Теперь давайте поищем строку аминокислот, которые встречаются в переводе на странице NCBI «VCG». Из-за пробелов на веб-странице перевода нам нужно искать на странице «V C G». Он должен быть в 5-футовом кадре 2.

Основания в праймере не отображаются в последовательности, и обычно первые несколько оснований содержат шум, поэтому давайте создадим праймер примерно на 50-100 оснований выше VCG.

 

Я выбрал в качестве предварительного примера: gagacgcgggcacggctgtc

 

Обратный праймер должен располагаться примерно на 50-100 оснований ниже R158.Итак, давайте найдем ДНК, связанную с последовательностью VRL, которая представляет собой аминокислоты 157-159. Я выбрал эту последовательность: agcgcctggcagtgtaccag

, но это не то, что нам нужно для обратного дополнения.

Дополнение: tcgcggaccgtcacatggtc

Обратное дополнение: ctggtacactgccaggcgct

 

Прямые и обратные праймеры для амплификации белка АроЕ, чтобы увидеть, есть ли у нас мутации, которые являются предикторами болезни Альцгеймера:

Переслать: gagacgcgggcacggctgtc

Реверс: ctggtacactgccaggcgct

 

Наконец, вы хотите найти праймеры в геноме человека, чтобы убедиться, что последовательность не повторяется где-либо еще (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

  • Использовать по одному праймеру
  • Выберите Human Genomic + Transcript для базы данных
  • Нажмите ВЗРЫВ

Похоже, ближе всего идентичность на 75%, что немного плохо, но не ужасно.

 

Праймеры можно заказать в IDT: http://www.idtdna.com/site

 

Разница между праймерами для ПЦР и праймерами для секвенирования

Основное отличие — праймеры для ПЦР и для секвенирования праймеры
 

В связи с последними достижениями в области молекулярной биологии были разработаны различные генетические методы, которые сделали процесс исследования различных аспектов предмета простым и точным. ПЦР и другие процедуры секвенирования являются двумя важными такими методами. Они используют разные подкомпоненты. Праймеры считаются основным подкомпонентом, общим как для методов ПЦР, так и для методов секвенирования. Праймеры для ПЦР используются для амплификации определенной последовательности ДНК, в то время как праймеры для секвенирования s используются в контексте секвенирования фрагмента ДНК с целью выявления его конкретного порядка нуклеотидной последовательности. Это ключевое различие между праймерами для ПЦР и праймерами для секвенирования.

СОДЕРЖАНИЕ

1. Обзор и ключевые отличия
2. Что такое праймеры для ПЦР
3. Что такое праймеры для секвенирования
4. Сходства между праймерами для ПЦР и праймерами для секвенирования
5. Сравнение бок о бок — праймеры для ПЦР и праймеры для секвенирования в табличной форме
6. Резюме

Что такое праймеры для ПЦР?

Полимеразная цепная реакция (ПЦР) — это генетический метод, который используется в области молекулярной биологии для амплификации одной или нескольких копий определенного сегмента ДНК и получения многих миллионов идентичных копий. В реакции ПЦР используются различные компоненты, включая праймеры. Праймеры представляют собой короткие нити ДНК длиной 18-25 нуклеотидов, что делает их совместимыми с начальной и конечной областями амплифицируемых фрагментов ДНК. Праймеры могут быть прямыми и обратными. Эти праймеры связываются с фрагментом ДНК в определенных точках, где они заставляют ДНК-полимеразу связываться с конкретным праймером в этом месте и инициировать синтез новой цепи ДНК.

Выбор праймеров является важным аспектом процесса ПЦР.Большое значение имеет выбор длины праймера. Идеальная длина должна быть 18-25 нуклеотидов. Если длина слишком короткая или слишком длинная, праймеры не будут связываться с последовательностью ДНК для точной амплификации. Слишком короткие праймеры приводят к неспецифическому отжигу праймеров в разных местах последовательности ДНК.

Рисунок 01: Праймеры для ПЦР

Содержание гуанина и цитозина (GC) в хорошем праймере должно быть в пределах 40-60. Температура отжига праймера и температура плавления являются жизненно важными факторами во время ПЦР.Температура плавления должна быть рассчитана точно, а температура отжига грунтовки должна быть на 5 0 С меньше температуры плавления. Температура плавления должна быть 60°C и 75°C. Слишком высокие или слишком низкие температуры приведут к снижению активности ДНК-полимеразы.

Что такое праймеры для секвенирования?

Праймеры для секвенирования используются в контексте секвенирования фрагмента ДНК с целью выявления его специфической идентичности. Для получения хороших результатов секвенирования важны высококачественные праймеры и матрицы.Таким образом, когда выбираются праймеры, они должны быть уникальными для конкретной области, которую мы хотим секвенировать. Он также должен быть с правильной ориентацией, когда последовательности обычно генерируются от 3’- до 5’-концов праймеров. В последовательности не должно быть нежелательной самогибридизации, такой как образование петель шпильки. Он не должен содержать последовательного образования гуаниновых оснований.

Температура плавления (Tm) праймера должна соответствовать условиям секвенирования.Следовательно, она должна находиться между 52 o C и 74 o C. Препарат олигонуклеотидов для использования в качестве праймера должен быть очищен для получения желаемой полноразмерной последовательности. Если олигонуклеотиды содержат примеси, сигнальные последовательности праймеров будут накладываться друг на друга из разных сайтов праймирования, что также приведет к уменьшению количества базовых клеток.

Рисунок 02: Праймеры для секвенирования

Температура плавления праймера (Tm) олигонуклеотида определяет, насколько сильно комплементарные нити ДНК гибридизуются друг с другом.Tm можно рассматривать как термодинамический расчет, где он зависит как от последовательностей ДНК, так и от нескольких условий, таких как концентрация соли. Tm важен во время ПЦР, где используется вариант, называемый циклическим секвенированием, для получения группы фрагментов, оканчивающихся дидезоксинуклеотидами. Здесь секвенированный праймер сначала альтернативно отжигают, затем удлиняют и, наконец, денатурируют для амплификации. Таким образом, значение Tm должно быть между 52 o C и 74 o C.Синтезированные олигонуклеотиды можно получить в лабораториях синтеза ДНК/РНК по выбору. Малый масштаб синтеза, который используется для секвенирования ДНК, обычно составляет 50 нмоль. Также, что наиболее важно, праймеры, используемые для секвенирования, должны быть очищены от примесей, которые предотвратят снижение качества.

В чем сходство между праймерами для ПЦР и праймерами для секвенирования?

  • И праймеры для ПЦР, и праймеры для секвенирования представляют собой праймеры, которые используются в процессе амплификации целевой последовательности ДНК.
  • И праймеры для ПЦР, и праймеры для секвенирования состоят из нуклеотидов.
  • И праймеры для ПЦР, и праймеры для секвенирования представляют собой короткие олигомеры.

В чем разница между праймерами для ПЦР и праймерами для секвенирования?

Праймеры для ПЦР

и праймеры для секвенирования

Праймеры для ПЦР представляют собой короткие нити ДНК с длиной последовательности нуклеотидов 18-25, что делает их совместимыми с начальной и конечной областью фрагментов ДНК, подлежащих амплификации. Праймеры для секвенирования представляют собой короткие олигомеры, которые используются в контексте секвенирования фрагмента ДНК с целью выявления его специфической идентичности.
Функция
Праймеры для ПЦР используются для амплификации определенной последовательности ДНК. Праймеры для секвенирования используются в контексте секвенирования фрагмента ДНК с целью выявления его специфической идентичности.
Необходимое количество грунтовок
Две грунтовки; один прямой праймер и один обратный праймер используются в качестве праймеров для ПЦР. Нужен только один праймер в качестве праймера для секвенирования.

Резюме –

Праймеры для ПЦР и  Секвенирование  Праймеры

Праймеры для секвенирования используются в контексте секвенирования фрагмента ДНК с целью выявления его специфической идентичности. Одного праймера для секвенирования будет достаточно для запуска процесса. Для получения хороших результатов секвенирования важны высококачественные праймеры и матрицы. Таким образом, когда выбираются праймеры, они должны быть уникальными для конкретной области, которую мы хотим секвенировать.Праймеры для ПЦР представляют собой короткие нити ДНК длиной 18-25 нуклеотидов, совместимые с начальной и конечной областью фрагментов ДНК, подлежащих амплификации. Праймеры для ПЦР могут быть прямыми и обратными. Содержание гуанина и цитозина (GC) в хорошем праймере должно быть в пределах 40-60. Температура отжига праймера и температура плавления являются жизненно важными аспектами во время ПЦР. В этом разница между праймерами для ПЦР и праймерами для секвенирования.

Артикул:

1.«Полимеразная цепная реакция (ПЦР)». Академия Хана. Доступно здесь
2. «Праймеры для секвенирования и дизайн праймеров». Секвенирование праймеров и дизайн праймеров | Основные услуги ДНК университета | Университет Калгари.

Posted in Разное

Добавить комментарий

Ваш адрес email не будет опубликован.