Праймер база и топ последовательность нанесения и инструкция: Пошаговая технология нанесения гель-лака

Праймер база и топ последовательность нанесения и инструкция: Пошаговая технология нанесения гель-лака

26.05.2021

Содержание

Как использовать праймер для лица

Праймер или основа – средство в виде крема, пасты или геля, которое наносится на все лицо или отдельные зоны поверх увлажняющего средства. Продукт служит базой для тонального крема и другой декоративной косметики, улучшает цвет лица, скрывает мелкие недостатки. Основа не окрашивает кожу, она ложится очень тонким слоем и остается незаметной. На поверхности не остается жирной или липкой пленки. Существуют базы для всего лица, а также для отдельных зон: губ или зоны вокруг глаз. Правильно подобранные праймеры способны:

  • закрепить макияж;
  • выровнять рельеф кожи;
  • матировать лицо;
  • придать коже приятный здоровый оттенок;
  • сохранить нормальный уровень влаги;
  • предотвратить закупоривание пор и появление мелких воспалений;
  • сделать лицо идеально гладким и сияющим.

В продаже представлены средства различных текстур, выбор зависит от типа кожи и характера макияжа. Самый распространенный вариант – база в виде легкого крема. Она подойдет для нормальной, сухой или комбинированной кожи. Средство имеет шелковистую текстуру, легко распределяется, скрывает мелкие морщинки и шелушения. Кремовые праймеры упаковываются в пластиковые тюбики с удобными дозаторами. Более плотный продукт может расфасовываться в баночки, к ним прилагается лопатка, которой удобно отмерять нужную порцию средства.

Выбор цвета и текстуры базы зависит от состояния кожи.

Для жирной кожи лучше использовать легкую гелевую базу на силиконовой основе. Она хорошо матирует, сглаживает расширенные поры, тональный крем, нанесенный поверх такой основы, ложится идеально ровно. Для чувствительной, склонной к раздражениям кожи лучше выбрать праймер на водной основе, не содержащую силиконов.

Возрастная кожа нуждается с подсвечивающем праймере со светоотражающими частицами. Он замаскирует мелкие морщинки, сделает лицо рельефным, придаст ему легкое сияние. Такое средство незаменимо для вечерних выходов, но некоторые женщины с успехом используют подсвечивающую основу и днем.

Выбирая оттенок, нужно учитывать общий цветотип. Девушкам с холодным подтоном лица подойдут лавандовые или белые основы, обладательницам теплой кожи лучше использовать золотистые или персиковые базы.

При выборе базы нужно учитывать и ее оттенок. Кроме бесцветных выравнивающих средств в продаже есть тонированные, способные решить самые разные проблемы. Выбрать нужный препарат поможет опытный консультант в магазине косметики.

  • Зеленая основа убирает излишнюю красноту, скрывает пятна, лопнувшие капилляры, воспалившиеся прыщи.
  • Сиреневая или розовая освежает цвет лица, делает его здоровым и отдохнувшим, убирает землистый оттенок.
  • Чисто-белая осветляет пигментные пятна, делает кожу фарфоровой и безупречно гладкой.
  • Золотистая придает более красивый оттенок загару, визуально омолаживает, подходит как для вечернего, так и для повседневного макияжа.
  • Персиковая – идеальный выбор для смуглой кожи. Выравнивает цвет, но не высветляет лицо.

Хороший праймер не только визуально улучшает кожу, но и способствует ее оздоровлению. В состав косметики могут входить микрогубки, поглощающие избыток жира. Поддержать необходимый уровень влаги поможет диметикон, циклометикон придаст лицу приятное сияние и здоровый оттенок.

Правильно подобранный праймер делает лицо идеально гладким и очень ухоженным.

Чтобы макияж выглядел идеально и продержался как можно дольше, кожу необходимо подготовить. Шелушащееся лицо можно обработать легким эксфолиантом. Жирную кожу протирают мицеллярной водой, гидролатом или тоником, не содержащим спирта. На очищенное лицо наносят легкий увлажняющий крем или сыворотку. Средство вбивают кончиками пальцев до полного впитывания.

После увлажнения можно наносить праймер подходящего цвета и текстуры. Нередко используется 2 средства. Например, на Т-зону накладывается база с матирующим эффектом, а на щеки и под глаза – увлажняющая.

Базу выдавливают из тюбика или достают из банки специальной лопаточкой, а затем распределяют кончиками пальцев, кистью или латексным спонжем. Растирать средство не нужно, благодаря легкой текстуре оно очень быстро впитывается. На зону с расширенными порами можно нанести еще один слой.

Праймер для лица можно наносить и на подвижное веко, он станет хорошей базой под тени и подводку.

Праймер распределяют по массажным линиям, начиная от центра лица и двигаясь к периферии. Сначала обрабатывается лоб, нос и щеки, в заключение средство наносится на подбородок. Не обязательно накладывать базу на все лицо, можно ограничиться лишь зонами, требующими дополнительной корректировки.

После распределения основы нужно дать ей впитаться. Когда лицо станет гладким, можно заняться нанесением тонального крема. В заключение кожа выравнивается рассыпной полупрозрачной пудрой, предпочтительно минеральной. Она не сушит кожу, создавая очень тонкое, невесомое покрытие.

Пользоваться праймером можно ежедневно. В конце дня косметика стирается мицеллярной водой или косметическим молочком, затем следует тщательное умывание с пенкой или гелем. Ложиться спать, не удалив макияж, нельзя. Лишенная нормального дыхания кожа отреагирует воспалениями, раздражениями, повышенной жирностью или сухостью.

Покрытие базой и топом без гель лака

Вы – любительница необычного, а долговечного маникюра? Любите, чтобы ноготки были идеальны без коррекции 2 -3 недели? Тогда вы точно знаете, где в городе можно сделать маникюр по самым выгодным ценам, где работает хорошие мастера, где лучшие материалы. А особо продуманные обзавелись лампами, шеллаками, базой и топом и вовсю экспериментируют дома.

Если вы полагаете, что основа и финишное покрытие в этом деле – нюанс, которым можете пренебречь, то очень ошибаетесь. Стандартный алгоритм гласит: база и топ, а посередине шеллак. Иного не дано, сохраняется и последовательность. Иначе не только ваши труды будут напрасны – покупка лампы для полимеризации и шеллака понравившегося цвета будет пустой тратой денег. Это трио друг без друга не может долго жить. Как же выбрать составляющие, которые определяют долговечность и защищенность ногтевой пластины и маникюра? Почему одни вам подойдут, а другие – нет, и от чего это зависит?

Базовое покрытие под гель-лак: функции, нанесение

Примем как должное, что база под пигментом должна быть всегда (кстати говоря, даже при маникюре обычным методом, обычными лаками).

Базовое средство в маникюре шеллаком необходимо для:

  • заполнения неровностей ногтя, выравнивания пластины;
  • защиты от окрашивания, проникания химического состава во время полимеризации;
  • укрепления природной пластины, укрепления свободного края;
  • сцепления ногтевой пластины с пигментированным лаком. С этой точки зрения база выступает праймером (праймер – вещество, которое готовит ноготь к нанесению лака).

А теперь поговорим простым языком о том, как правильно использовать праймер (базу), чем это сделать и какой при этом должна быть поверхность ногтя:

  1. После обычного гигиенического маникюра и коррекции свободного края сначала обязательно нужно зашлифовать пластины. Делаем это специальным шлифовщиком (по форме как обычная плоская пилка) или бафом. Причем используем самую жесткую его грань. Проходимся, в том числе по торцам. Есть места возле кутикулы, где большая по площади пилка не достает. В этом случае используем маленькую. Наша цель – не снимать верхний слой ноготка, а только лишь удалить глянец, не травмируя ногтевую пластину. Но снимать жир и глянец будем равномерно и полностью по ногтю.
  2. После убираем образовавшуюся пыль специальной щеткой или полировочной тканью.
  3. Потом обработайте ногти дезинфектором или обезжиривателем. Специальные жидкости улучшат адгезию, глубоко очистят ногти и соседние ткани. Но можете воспользоваться и обычной ЖДСЛ, которая обойдется во много раз дешевле.
  4. Если вы знаете, что плохо переносите лаковые средства (они не носятся долго, в силу физиологических особенностей отторгаются, снимаются пластами уже через неделю даже при условии правильно выполненного маникюра), можете по периметру для еще лучшей адгезии нанести небольшое количество специального праймера (жидкости водной консистенции с кисловатым насыщенным запахом, которая так и называется).
    Ждем высыхания такого праймера без лампы около минуты.
  5. После этого наносим праймер-базу. Тонким слоем, равномерно, не набирая много жидкости на кисть.
  6. Кисть можно брать оригинальную, которая во флаконе со средством. А можете купить кисть с длинной ручкой, сплющенную, с закругленными краями и жестким ворсом, которой пользуются профессионалы. Это, скорее, вопрос привычки.
  7. Обязательно обрабатываем торец, только не заливаем базовый состав под ноготь, а проходимся по торцу кистью с небольшим количеством средства.
  8. Такой праймер, в отличие от пигмента, стараемся намазать втирающими движениями максимально близко к кутикуле.
  9. Наносим один тонкий слой вещества, для укрепления проблемной зоны немного утолщаем его.
  10. Потом базу сушим, в среднем минуту в обычной УФ-лампе или 10 секунд в LED-лампе.
  11. Липкость не снимаем. Липкий слой служит для лучшего сцепления.

Только теперь можно наносить понравившийся цвет, отступая от кутикулы на 1 миллиметр (если вы только вникаете в этот творческий процесс, не являетесь профессионалом с поставленной к этому процессу рукой).

Все про топ-гель

Завершающим этапом маникюра (но перед нанесением ухаживающих масел) обычно есть нанесение и сушка топа.

Топ-гель (топ, финиш, финиш-гель) предназначен для:

  • Защиты слоя цветного лака от агрессивной внешней среды (моющие средства, солнце, кислые растворы).
  • Для защиты от механических повреждений, царапин, порезов;
  • Это прозрачный щит, на котором отображаются все удары, в то время как сам ноготь и цвет остаются нетронутыми.
  • Топ придает характерный блеск;
  • Топ может иметь мерцающий эффект, благодаря чему в маникюр можно добавить интересную изюминку;
  • Топом закрепляют элементы декора и дизайн. Если у вас на ногтях объемное творение искусства, можно нанести 2 слоя топ-геля.

Топ-покрытие тоже имеет особенности и четкие правила:

  1. Наносим его на липкий слой цветного покрытия.
  2. Слой топ-геля должен быть более толстым, чем праймера-базы. Но не перестарайтесь, чтобы он не оплыл на одну сторону.
  3. Запечатываем ноготь топом отжатой кистью.
  4. Покрытым и липким должен быть весь ноготь, даже труднодоступные места возле кутикул.
  5. Желательно перекрыть периметр цветного покрытия.
  6. Потом топ сушим 2 минуты или 30 секунд в LED-лампе. Если топ просушить недостаточно, маникюр быстро утратит блеск, на нем будут отпечатываться потертости и царапины, сколы на свободном крае гарантированы уже через несколько дней.
  7. Снимаем липкий слой клинсером или, как мы уже упоминали, жидкостью для снятия лака. Очень тщательно, со всех сторон и торец.
  8. На топ уже ничего не рисуем, не посыпаем, не клеим. Иногда финиш может служить липкой основой для страз, но лишь в том случае, если камень поверх не будет ничем покрываться (например, чтобы не смазать оттенок у камня).
  9. После снятия липкого слоя наносим ухаживающее и замедляющее рост кутикулы средство.

Если во время нанесения и сушки вы придерживались технологии, последовательности, то маникюр продержится пока отрастет ноготь, и не появится необходимость его коррекции из чисто эстетических соображений. К тому же натуральная ногтевая пластина будет защищена надежно, а значит, вы почувствуете еще одно важное преимущество шеллака.

Оба этих вещества прозрачные или слегка мутные, имеют немного вязкую консистенцию. В зависимости от производителя время просушки может отличаться.

Отметим, что лет 5 назад на рынке представили цветной топ-гель без дисперсионного (липкого) слоя. Однако современные однофазные гель-лаки сами по себе после помещения в УФ-лампу наделяются этими же функциями. В этом случае топ-покрытием можно пренебречь.

База и топ – защитная оболочка, которая правильно надежно охватывает и защищает декор или сплошное покрытие шеллаком, замыкая круг на кончике ногтя.

Как выбрать топ и базу

Чтобы базовый состав и финиш полностью выполняли свои функции, а значит — продлили жизнь маникюру, защитили натуральный ноготь, нужно потрудиться их правильно выбрать, в соответствии с маркой гель-лака. Если вы предпочитаете шеллак, тоже надо подобрать соответствующие средства. Вам помогут общие правила и знание нескольких нюансов:

  1. Если вы пользуетесь шеллаком, подойдет фирма Коди, Блюскай или CND – они «дружат» практически со всеми гель-лаками. Средство какой-либо другой фирмы может конфликтовать.
  2. Базу и топ предпочтительнее купить одной фирмы и соответственно гель-лак.
  3. Если вы несколько ограничены в средствах, купите цветной лак по дешевле, но на топе и базе экономить не стоит. Дело в том, что, как мы выяснили, именно они отвечают за стойкость и блеск маникюра.
  4. Мастера утверждают, что все дополнительные проверенные жидкости средней и высокой ценовой категории обладают более-менее неплохими характеристиками. Однако некоторые могут иметь дополнительные свойства. Например, иногда их обогащают гидролизированным кератином. Это даст вам преимущество в виде дополнительного ухода за пластинами и продления стойкости маникюра за счет повышенной приобретенной монолитности. В случае, если у вас тонкие ногти, подобное средство для укрепления рекомендуют наносить самостоятельно.
  5. Если пластины неровные, поврежденные, имеет смысл использовать более густую базу для лучшего укрепления.
  6. Если пластины тонкие, используем густой топ. Что касается конкретных производителей и названий продукта, то тут ориентируйтесь на то, подходит ли средство вашему гель-лаку. Это можно уточнить у продавца, на официальных сайтах, в инструкции. Более-менее универсальными считаются средства от Kodi и Блюскай.
  7. Немаловажную роль играет и удобство использования конкретного средства. Флакон должен быть удлиненным, чтобы большое количество средства не оставалось на дне из-за невозможности его быстро достать кистью. Он должен быть устойчивым. Сама кисть должна быть плотной, густой, ровно или слегка закругленно срезанной, ворсинки не должны топорщиться, ручка должна хорошо ложиться в руку. Ведь надо наносить быстро и аккуратно.

Заменить базу и топ нельзя ничем, вместо них не подойдет никакое средство, и отличаются они очень сильно, так что выбор делать придется. И не факт, что он сразу будет правильный.

В любом случае нужно проконсультироваться с мастером или грамотным продавцом, либо консультантом. Или запомните наши рекомендации и потом отправляйтесь за удачными покупками.

База для гель – лака – это универсальное средство, которое предназначено для первоначального покрытия ногтевой пластины, обеспечивающее лучшее дальнейшее сцепление материала с поверхностью ногтей. В этой статье мы разберемся в чем же ее особенность и почему она так необходима каждому мастеру.

Какую роль играет база?

База является залогом хорошего и стойкого маникюра. Она предназначена для обеспечения наилучшего сцепления гель-лака с поверхностью ногтевой пластины. База защищает возможное негативное воздействие гель-лаков на естественную структуру ногтя. Как правило, она не имеет цвета, хорошо ложится на ноготь, выравнивая и немного укрепляя его. Некоторые производители создают каучуковые базы, которые имеют большую вязкость и заменяют процедуру укрепления ногтей гелем. Каучуковые базы плотнее обычных баз, но предназначение имеют все то же – обеспечение наилучшего сцепления гель-лака с поверхностью ногтя и защита от негативных воздействий компонентов продукта. Некоторые базы имеют небольшие оттенки розового и бежевого тонов. Мастера могут использовать базу как самостоятельное покрытие, не требующее дополнительного нанесения поверх цветного лака.

Можно ли наносить гель без базы?

Если мы говорим о трехфазной системе гель-лаков, то ответ очевиден – нет. База и гель-лак – это два неразлучных продукта, которые по отдельности очень плохо взаимодействуют с поверхностью ногтевой пластины. Без базы покрытие гель-лаком продержится около 2-3 дней, так как материал будет недостаточно «схвачен» с ногтями. Нанесение базы обеспечит стойкое и красивое покрытие около 2-4 недель. Завершается трехфазная система нанесением специального закрепляющего средства – топа, без которого покрытие тоже «слезет» раньше времени.

Однако современные технологии дошли до превосходной степени. На рынках появляются все новые и новые продукты, позволяющие заметно облегчить проведение процедур.

Однофазная система гель-лаков – это система, позволяющая выполнять маникюр при использовании одного лишь продукта. Во флаконе содержится и база, и цвет, и завершающее топовое покрытие. Этот экспресс – вариант хоть и заметно сокращает время работы, но оставляет за собой большой недостаток – он имеет меньшую износостойкость, нежели обычное трехфазное покрытие.

Техника нанесения гель-лака очень проста. Она требует не столько навыков и знаний, сколько аккуратности и большой внимательности и усидчивости. Первые работы могут получаться не аккуратными, но это всего лишь дело времени, техники и наработки опыта. Зная определенные правила, процедура гель-лака оказывается по силам любому мастеру, решившему развиваться в данном направлении.

Правила нанесения гель-лака.

  1. Первым делом необходимо обработать поверхность ногтей, сделать обрезной или классический аппаратный маникюр, пройтись по поверхности ногтей специальным бафом, позволяющим отшлифовать ногтевую пластину.
  2. Далее ноготь обезжиривают специальным средством и наносят базу под гель-лак.
  3. Следующим этапом идет нанесение цветного гель-лака и создания дизайна на ногтях. Этот этап занимает самое большое время во всей процедуре, так как требует качественного нанесения материала и хорошей просушки в УФ-лампе.
  4. После нанесения цвета необходимо закрепить результат последним покрытием – топом, обеспечивающим защиту всего материала от воздействий окружающей среды.

Гель – лак – это очень популярная процедура среди девушек, которые желают сделать свои ногти красивыми и ухоженными. Для того, чтобы маникюр радовал вас долгое время, необходимо тщательно выбирать мастера, который использует в своей работе только лучшие материалы.

Обязательным условием для современной женщины являются красивые и ухоженные руки. Но из-за постоянной нехватки времени делать маникюр регулярно (каждые полторы недели) просто не предоставляется возможным. Поэтому настоящим волшебством считается система гель-лаков: она длительна в ношении и не требует постоянной коррекции.

Современная индустрия красоты предлагает представительницам прекрасного пола большой выбор покрытий для ногтей. Это обычный лак, лак который держится до двух недель на руках и до четырех на ногах, система гелевого и акрилового наращивания, полигель (гибрид геля и акрила), а также самая популярная и востребованная процедуру – гель-лак. Его и рассмотрим подробнее.

Правила нанесения гель-лака

Для того чтобы ответить на волнующий вопрос, можно ли наносить гель-лак без базы, следует узнать правила нанесения состава.

  • Для начала нужно подготовить ногтевую пластину. Придать форму ногтю, отодвинуть кутикулу и удалить птеригий.
  • Далее бафим ноготь, чтобы снять лишний блеск и выровнять ногтевую пластину.
  • Убираем пыль и обезжириваем ноготь.
  • Наносим праймер. Ноготки должны немного посветлеть, это значит, что чешуйки раскрылись для сцепления с материалом.
  • Далее наносят базу и сушат в лампе.
  • Теперь пришло время цветного покрытия, самого гель-лака.
  • И в конце – топовое покрытие.

Можно ли наносить гель-лак без базы?

База является залогом хорошего и качественного маникюра. Она защищает ногтевую пластину от неблагоприятного воздействия гель-лака, обеспечивает сцепление натурального ногтя с покрытием и предотвращает проникновение красящих пигментов в него. Если у вас аллергия на гель-лак, база поможет защитить вас от последствий. Если же не нанести базу, то ваш маникюр не продержится и пары дней, все быстро отпадет и сколется. Можно ли наносить гель-лак без базы? Ответ однозначный: конечно же, нет.

Гель-лак – что это за система?

Существует две системы гель-лаков: трехфазная и однофазная. Что же это значит?

Трехфазная система состоит из трех компонентов, каждый из которых помещен в отдельную емкость.

  1. База, которая обеспечивает сцепление с гель-лаком.
  2. Само цветное покрытие.
  3. Финишное покрытие, его еще называют топом, который закрепляет покрытие.

Такое покрытие является стойким и обеспечит вам красивый маникюр в течение трех недель. Но следует помнить, что все эти шаги обязательно нужно выполнять и ни в коем случае не менять их местами. Можно ли наносить гель-лак без базы в трехфазной системе? Нет, этого делать ни в коем случае нельзя.

Однофазную систему еще называют «три в одном». В одном флаконе сразу содержатся все три компонента – основа, цвет и закрепитель. Это своего рода экспресс-вариант. Но у него есть существенные недостатки. Он не всем подходит, его носкость значительно короче, чем у трехфазной системы и, самое главное, вы не сможете сделать дизайн. Так что любительницам страз, слайдеров и блесток этот вариант однозначно не подходит.

Выходит, что гель-лак без базы можно наносить только в том случае, если вы используете однофазную систему.

Топ лучших гель-лаков

Существует огромное количество марок гель-лаков. В них легко потеряться, особенно новичку. Представляем десять лучших производителей продукта.

  1. CND – это фирма по праву считается лучшей. Именно создатели этого бренда первыми смогли соединить гель и лак в одном флаконе. Их продукция считается люксовой, на них ориентируются многие.
  2. Kodi professional.
  3. Masura.
  4. Opi.
  5. Orly.
  6. TNL.
  7. Bluesky.
  8. RuNail.
  9. Canni.
  10. Lovely.

У каждого производителя есть свои плюсы и минусы. Цена, консистенция, кисточка, стойкость, цветовая палитра и другие характеристики.

Какой вариант выбрать для своих ногтей – это дело сугубо индивидуальное. Все зависит от вашего желания, возможностей и времени. Рассмотрев вопрос, можно ли красить гель-лак без базы, мы разобрались, что этого делать нельзя, если это трехфазная система. А при однофазной очень даже можно.

Пошаговая инструкция как красить ногти гель-лаком дома — BANGLEMEN

Как делать гель-лак пошагово для начинающих: как наносить, инструкция, видео

Делать гель-лак пошагово для начинающих – задача не очень сложная, многие модницы уже опробовали его нанесение в домашних условиях и отказались от услуг маникюрных салонов. Для того чтобы любая девушка могла самостоятельно выполнить простой дизайн гель-лаком, ей необходимо знать саму технологию нанесения и некоторые важные нюансы.

Что такое покрытие гель-лаком

Гель-лаковое покрытие за короткое время набрало огромную популярность среди женщин, следящих за своим внешним видом и желающим выглядеть идеально в любых ситуациях. Гель-лак представляет собой гибрид геля и лака, который отлично держится на ногтях в течение нескольких недель. Такое покрытие долговечно, не скалывается и не трескается под продолжительным воздействием воды, химических средств для уборки и других факторов. И если обычный лак на ногтях может выглядеть не эстетично уже в течение нескольких часов после нанесения, то гель-лак будет украшать женские руки минимум 2 недели.

К достоинствам покрытия гель-лаком относятся:

  • удобство и быстрота нанесения;
  • отсутствие неприятного запаха;
  • большой выбор расцветок и техник нанесения;
  • долговечность и декоративность.

Главный недостаток гель-лака проявляется при отрастании ногтя: неокрашенные участки у основания выглядят неаккуратно и портят вид маникюра. Но использование некоторых техник, например, френча, помогает избежать этой неприятности.

Что нужно для маникюра гель-лаком

Чтобы приступить к созданию дизайна, нужно сначала собрать все необходимые принадлежности:

  • маникюрный набор для подготовки ногтей к нанесению покрытия;
  • лампу;
  • базовое и финишное покрытия;
  • цветной гель-лак;
  • обезжириватель;
  • питающий крем для ногтей и кутикул.

Для лучшего сцепления покрытия с поверхностью ногтевой пластины можно использовать праймер – специальный состав, который следует накладывать на подготовленные ногти перед нанесением базы.

Как подготовить ногти к гель-лаку

Перед тем как приступить к выполнению маникюра гель-лаком по шагам, необходимо правильно подготовить ногтевые пластины – только на ухоженных руках покрытие будет смотреться эстетично и привлекательно.

Сначала при помощи пилочек различной абразивности придают желаемую форму. Она должна быть ровной и одинаковой на всех ногтях. Кутикулы отодвигают с помощью специальной палочки, обрезают. Обычно при проведении стандартного маникюра используют ванночку для распаривания пальцев. При таком способе должно пройти не менее 1 ч перед нанесением гель-лака.

Бафиком (пилкой для шлифовки) отшлифовывают и выравнивают верхнюю поверхность пластины. После обработки она должна стать матовой, утратить глянцевидность. Сильно надавливать на пилку не нужно, шлифовку проводят легкими движениями. Эта процедура необходимо для лучшей сцепляемости покрытия с поверхностью ногтя.

Обезжиривание ногтей – заключительная стадия подготовки к нанесению гель-лака. Здесь пользуются ватными дисками, смоченными в специальном обезжиривателе, жидкости для снятия лака или спирте. Ногти тщательно протирают, иногда эту процедуру повторяют.

Последовательность нанесения гель-лака

Пошаговая инструкция, подробно описывающая процесс нанесения гель-лака в домашних условиях, поможет начинающим сделать красивый маникюр самостоятельно.

Нанесение базового покрытия

Базовое покрытие отвечает за прочность маникюра, а также дополнительно выравнивает ногтевую поверхность. Поэтому от качества базы зависит качество всего нанесения. На кисточку набирают немного базы и покрывают ей ноготь, двигаясь от центра пластины к кутикуле, а затем к свободному краю. Базовое покрытие наносят тонким слоем, распределяя его по всей поверхности пластины, не забывая о ее торцах. После того как база нанесена, ногти просушивают в лампе. С момента наложения базы на ногти важно следить за тем, чтобы на их поверхность не попадали пылинки, волоски и прочий мелкий мусор, иначе качество маникюра будет низким.

Важно! После просушки на поверхности нанесения образуется липкий слой. Его удалять не нужно, так как именно он отвечает за качественное и крепкое сцепление слоев маникюра.

Покрытие ногтей цветным гель-лаком

Большая палитра оттенков гель-лака позволяет создавать интересный и разнообразный дизайн ногтей. Для начинающих модниц, использующих гель-лак самостоятельно в домашних условиях, рекомендуется воспользоваться самым простым вариантом и нанести только один понравившийся цвет.

Цветом аккуратно и равномерно покрывают ногтевую пластину. Не стоит переживать, если получившийся слой просвечивает или лег полосами. Зачастую может понадобиться несколько слоев лака, чтобы покрытие получилось идеальным.

Важно! Не рекомендуется нанесение гель-лака толстым слоем: обычно его наносят пошагово, в 2-3 приема, после каждого из них просушивают ногти в лампе.

Нанесение финишного покрытия

Финишное покрытие, иначе топ, наносят для закрепления результата. Именно оно отвечает за долговечность маникюра, предохраняет поверхность от царапин и повреждений. Структура топа может быть глянцевой или матовой. Маникюр с топом без липкого слоя прост и подойдет для новичков.

Любительницам дополнительных декоративных элементов (камешков и страз) рекомендуется пользоваться финишным покрытием с липким слоем, ведь именно на нем закрепляются украшения. По окончанию работы липкий слой топа снимают обезжиривателем.

Все этапы нанесения гель-лака в домашних условиях очень важны, ни один из них пропускать нельзя.

Видео-урок маникюра для начинающих пошагово:

Как правильно красить гель-лаком ногти

Глядя на пошаговую инструкцию, можно подумать, что маникюр дома своими руками – дело совсем несложное.

Существует несколько нюансов, которыми никак нельзя пренебрегать при создании красивого качественного маникюра:
  1. В зависимости от вида используемой лампы продолжительность просушки базы, цвета и топа может быть разной: в UV-лампе она составляет 2 минуты, в LED-лампе – всего 30 секунд.
  2. Базу и топ наносят исключительно в один тонкий слой, а слоев цвета может быть несколько.
  3. Нельзя использовать финишное покрытие вместо базового и наоборот. У этих двух средств совсем разные функции.
  4. Самый лучший эффект достигается при выборе базы, топа и цвета одного и того же производителя.
  5. Если гель-лак наносят на нарощенные ненатуральные ногти, их не делают слишком толстыми, иначе наложенный в несколько слоев гель-лак будет выглядеть не эстетично.
  6. Перед выполнением рисунка и нанесением дополнительных слоев гель-лака каждый из них просушивают в лампе.
  7. Все приклеенные стразы и камешки сверху закрепляют финишным покрытием, тщательно промазывая все промежутки между ними.

Многослойный дизайн нуждается в хорошей окончательной просушке, ее время увеличивают в 1,5 раза (по сравнению с обычной просушкой каждого слоя).

Все эти правила помогут создать качественный маникюр с покрытием гель-лак самостоятельно в домашней обстановке.

Как правильно снять гель-лак

Правильное снятие гель-лака – не менее ответственный процесс, чем его нанесение. Неверно проведенные манипуляции способствуют травмированию ногтевой пластины. Чтобы этого не произошло, нужно действовать по общей пошаговой инструкции:

  1. Руки промывают водой, сушат, сбрызгивают антисептиком.
  2. Ватные тампоны (для удобства каждый из них разрезают пополам) смачивают в жидкости для снятия гель-лака и накладывают на пальцы. Закрепить вату можно кусочками фольги, обмотав ими пальцы сверху.
  3. В таком состоянии выдерживают в течение 10-20 минут, в зависимости от времени, указанного производителем жидкости. За это время состав размягчит гель-лак.
  4. Когда время истечет, фольгу и вату удаляют. Если какая-то часть покрытия все же осталась на ногте, ее аккуратно счищают апельсиновой палочкой.
  5. Для того чтобы окончательно очистить ногтевую пластину, ее шлифуют бафиком. После этого ей придают желаемую форму.
  6. Завершающим действием снятия гель-лака является обработка ногтей, кутикул и кожи пальцев масляными питающими составами.

Перед тем как заново наносить дизайн, старое покрытие нужно обязательно тщательно снять.В противном случае новый маникюр будет шероховатым и некачественным.

Советы начинающим

Даже при соблюдении всех правил и технологии нанесения гель-лака результат может оказаться не лучшим. Профессиональные мастера маникюра охотно делятся с начинающими некоторыми секретами, которые помогут создать красивый маникюр гель-лаком даже в домашних условиях:

  1. При сушке пальцы в лампе нужно держать строго горизонтально. Даже при небольшом наклоне на ногтях могут возникать неэстетичные наплывы и затеки лака.
  2. Начинающие мастера зачастую не обращают внимания на срок годности выбранных составов. Качество цветного гель-лака, топа и базы с истекшим сроком годности резко снижается, поэтому не следует их использовать для маникюра.
  3. Для того чтобы достать цветной пигмент лака и его перемешать перед началом работы, не нужно активно взбалтывать пузырек – его просто перекатывают между ладоней. Из-за сильной и быстрой тряски лак пузырится.
  4. Гель-лак проявляет свою стойкость только при тщательном прокрашивании всей поверхности ногтя, включая его свободный край. Если пропустить какой-либо участок, уже в течение первых дней после создания маникюра на нем появляются сколы и трещины.

Мастера при выполнении маникюра гель-лаком в домашних условиях советуют начинающим не торопиться и наносить каждый слой состава поэтапно и аккуратно.

Идеи маникюра гель-лаком для начинающих

Существует множество интересных и красивых идей маникюра гель-лаком, но далеко не каждую из них на своих ногтях сможет реализовать начинающий мастер без специальных уроков у профессионалов.

В фотогалерее собраны симпатичные дизайны гель-лаковых покрытий, которые сможет сделать каждый начинающий.

Заключение

Делать гель-лак пошагово для начинающих – уже не проблема. Благодаря подробной инструкции нанесения и описанию всевозможных нюансов и особенностей, можно самостоятельно, даже без какого-либо опыта, сделать красивый маникюр дома.

Как аккуратно накрасить ногти гель лаком: пошаговая инструкция от профессионалов

Инструкция по аккуратному нанесению гель-лака

Делать маникюр дома самостоятельно не всегда просто и удобно, но на посещение мастера порой не хватает ни времени, ни денег. Поэтому даже такие процедуры как гель лак или шеллак становятся все чаще домашними, тем более что приобрести необходимые инструменты и материалы совсем несложно. Гораздо больше усилий требуется для создания оригинального и аккуратного маникюра, который долгое время сможет радовать свою обладательницу ухоженным видом.

Чтобы понять, как красиво накрасить ногти, и научиться делать это в домашних условиях, нужно понимать особенности и отличия обычного маникюра от гель лака. Кроме того, необходимо изучить правила нанесения гель лака и хитрости, чтобы это получилось аккуратно. Ведь многие девушки сталкиваются с тем, что после завершения маникюра приходится очищать кожу и кутикулу от лишнего лака.

Дополнительная информация! Гель лак имеет множество преимуществ по сравнению с обычным покрытием ногтей, поэтому становится все более популярным среди девушек разного возраста. Он гораздо дольше держится на ногтях и даже через несколько недель выглядит ярко и привлекательно.

Среди других плюсов такого маникюра можно назвать:

  • подходит для девушек с тонкими и ломкими ногтями, которые не могут отрастить свои;
  • быстро наносится и высыхает под лампой;
  • не тускнеет и не теряет блеска на протяжении нескольких недель;
  • гель лак безопасен и гипоаллергенен, поэтому подходит для всех;
  • не портится от домашней работы, воздействия воды и даже огородных работ.

Именно такое количество плюсов делают гель лак таким популярным, а доступность материалов и инструментов позволяет делать его в домашних условиях.

Особенности нанесения гель лака

У мастера маникюра нанести гель лак в салоне получается легко и быстро, а держится он 2-3 недели. Самостоятельно сделать это не так просто, как хотелось бы, но нет ничего невозможного для человека, который хочет получить нужный результат. Чтобы в домашних условиях правильно и аккуратно нанести гель лак, нужно понимать особенности этого покрытия. Технология включает в себя несколько основных нюансов и хитростей:

  1. Важно подготовить ногтевую пластину к нанесению гель лака. Ноготь должен быть идеально ровным и отполированным, тогда получится обеспечить максимально правильное сцепление его поверхности с лаком.
  2. Удалить верхний глянцевый слой ногтя, используя пилочку с высокой абразивностью. Пыль очистить специальной щеточкой, руками к ногтям прикасаться нельзя, иначе гель лак будет лежать не плотно.
  3. Для укрепления ногтевой пластины и более плотного сцепления ногтя и гель лака требуется нанесение базового покрытия – бескислотного праймера. Процедура такого грунтования ногтя продлит срок эксплуатации сделанного маникюра.
  4. Вторым слоем наносится базовый гель. Он является связующим звеном между основным покрытием и природными составляющими ногтя. Гель наносится тонким слоем и подставляется под УФ-лампу для правильного высыхания.
  5. После этого можно наносить цветной лак, а сверху еще один слой геля. Затем снова полимеризация в лампе. Важным нюансом нанесения завершающего слоя гель лака является прокрашивание торца ногтя, как бы запечатывание.

Процедура нанесения гель лака обязательно должна включать такие этапы, чтобы он держался долго, не облущивался и не трескался. Правильно нанесенный лак на протяжении длительного времени выглядит привлекательно.

Как защитить кутикулу и кожу во время маникюра?

Помимо соблюдения особой технологии маникюра при помощи гель лака, нужно также учитывать особенности его нанесения, чтобы аккуратно прокрасить всю поверхность ногтя, но не вылезти на кожу и кутикулу.

Обратите внимание! Многие девушки знают, что такое мастерство возможно лишь с опытом, ведь делать маникюр самой себе неудобно. Однако существует несколько секретов, которые позволяют улучшить качество нанесения лака и общего результата.

В процессе работы нужно помнить о таких нюансах:

  1. Перед началом процедуры ухода за ногтями нужно обрезать ороговевший слой кутикулы. Для этого кожу нужно размягчить в теплой воде и апельсиновой палочкой отодвинуть кутикулу как можно дальше.
  2. Перед непосредственным нанесением лака на один ноготь, нужно постараться свободным пальцем отодвинуть кутикулу, чтобы лак лег как можно ближе к коже. Тогда маникюр дольше будет выглядеть свежим.
  3. По краю ногтя на кожу и кутикулу можно нанести специальное защитное средство или любой жирный крем, который не даст лаку впитаться. Стереть его потом будет гораздо проще.
  4. Красить ноготь нужно начинать с боков, а затем провести кисточкой по центру. Это обеспечит наиболее ровное покрытие. При этом начинать лучше с мизинцев, а последним прокрашивать ноготь большого пальца.

Безусловно, основным секретом красивого маникюра является аккуратность в процессе работы. Все девушки знают, что спешка при нанесении и сушке лака обязательно приведет к накрашенной коже, царапинам и неровностям на его поверхности. Поэтому выбирать время для маникюра нужно с тем расчетом, чтобы никуда не торопиться. Тогда даже рисунки и сложный дизайн получится сделать красиво и привлекательно.

Инструменты для идеального маникюра в домашних условиях

Важным фактором в домашнем маникюре является не только вопрос, как аккуратно накрасить ногти гель лаком, но также – чем его сделать. Набор инструментов профессионального мастера позволяет выполнять любые операции и добиться желаемого эффекта при помощи различных приспособлений. В домашних условиях приобрести качественный и дорогой набор не всегда получается, но хотя бы базовые инструменты, без которых не получится сделать ни один маникюр, нужно иметь.

К основным приспособлениям, материалам и инструментам для домашнего ухода за ногтями относятся:

  1. маникюрные ножнички для обрезки кутикулы;
  2. отросшие ногти зачастую подрезают щипчиками или кусачками, чтобы не тупить ножницы;
  3. деревянные палочки;
  4. пилочки средней и высокой жесткости;
  5. полирующий баф;
  6. дезинфицирующая жидкость;
  7. вата или ватные диски.

Для гелевого маникюра нужны также специальные лаки, основы и покрытия для ногтей, каждый из которых имеет свое назначение и особенности нанесения. После покупки важно внимательно ознакомиться с правилами их использования, чтобы получить максимальный результат. Не стоит также пренебрегать базовой основой и финальным покрытием, от которых зависит не только крепость и длительность ношения маникюра, но и внешний вид ногтей.

Таким образом, красивый маникюр в домашних условиях зависит от множества факторов. И если приложить усилия, получится сделать его аккуратным, красивым и качественным.

Фото покрытия ногтей гель-лаком

Еще больше фото по ссылке: Гель-лак фото.

Видео с мастер классом

[smartcontrol_youtube_shortcode key=»Как аккуратно накрасить ногти гель лаком» cnt=»2″ col=»2″ shls=»false»]

Facebook

Twitter

Вконтакте

Google+

Как сделать гель-лак? Гель-лак пошагово

В современном ритме жизни мы стараемся все процессы оптимизировать, что бы меньше тратить на них время и энергии. Не обошло это стороной и индустрию красоты. Одной из самых популярных процедур можно по праву считать покрытие гель-лаком.

В этой статье мы поговорим про преимущества такого покрытия, и как сделать маникюр гель-лаком в домашних условиях с пошаговой инструкцией.

А когда разберемся с покрытием, подсчитаем выгоду от покрытия в домашних условиях по сравнению с походом в салон.

Преимущества гель-лакового покрытия

Гель-лак не просто так полюбился представительницам женского пола.

А за его отличные качества и красивый результат.
  1. Самый главный плюс — это стойкость покрытия. Именно это свойство покорило миллионы женщин во всем мире. Теперь не нужно перекрашивать ногти каждые 2-3 дня для поддержания идеальной красоты ваших рук.
  2. Помимо стойкости гель-лак со временем не теряет глянцевый блеск и не тускнеет.
  3. Важным плюсом можно назвать защитную функцию покрытия. С таким покрытием вашим ногтям не страшен вред от внешнего воздействия, такого как механические повреждения, бытовая химия, вода, ультрафиолетовое излучение и т. п.
  4. В разнообразии палитр гель-лаков, декоров и техник выполнения дизайнов ногтей можно заблудиться. Хочется все и сразу! Благодаря этому огромному выбору можно каждый раз придумывать интересный маникюр, воплощая свои фантазии в реальность и проявлять индивидуальность.
  5. Так же по сравнению с простым лаком, у гель-лака нет резкого запаха.
Материалы для маникюра гель-лаком

Для идеального покрытия ногтей с длительным эффектом вам обязательно пригодятся такие материалы:

Как сделать гель-лак в домашних условиях

Вот мы и подобрались самой важной части статьи. Как наносить пошагово гель-лак в домашних условиях.

Этап 1. Подготовка ногтей

Прежде чем приступать к покрытию ногтевой пластины, необходимо подготовить ее. Для этого нужно снять все возможные покрытия (лак, гель-лак, гелевое наращивание). Мы уже писали статью о методах снятия гель-лака, ее можно почитать здесь.

Также к этапу подготовки относится маникюр и формирование свободного края ногтя:

  • пилочкой с абразивностью для натурального ногтя (от 180 грит и выше) оформите свободный край ногтя, движения должны быть плавными и направлены от края к центру ногтя;
  • бафом нужно зашлифовать всю поверхность ногтевой пластины, особенно уделяя внимание основанию ногтя и боковым краям. Если маникюр гель-лаком делается впервые важно выполнить этот этап максимально качественно — поверхность ногтя должна быть шершавой;
  • с помощью пушера или апельсиновой палочки отодвиньте кутикулу у основания ногтя;
  • сделайте маникюрную ванночку с мыльной теплой водой, опустите в нее пальцы и подержите 5-10 минут;
  • с помощью маникюрных ножниц или накожниц (кому как удобнее) аккуратно обрежьте кутикулу и обработайте боковые валики, старайтесь обрезать максимально чисто, что бы не образовывались заусенцы.

После этих процедур наши ногти почти готовы к долгожданному покрытию, осталось несколько немаловажных этапов.

Этап 2. Очищение от пыли и влаги

  • наши ногти сейчас после мыльной воды и пыли, поэтому их нужно тщательно обезжирить с помощью специального средства и безворсовых салфеток. После этого нельзя ничем прикасаться к ногтевой пластине, что бы ее опять не испачкать;
  • на обезжиренные ноготки нужно нанести праймер (ультрабонд), используйте безкислотный если ногти нормальные; если проблемные или очень влажные (по своей структуре) воспользуйтесь кислотным. Безкислотный наносится на весь ноготь очень тонким слоем избегая попадания на кожу и кутикулу, кисть нужно отжать. Кислотный наносят только на край ногтя, тоже очень тонким слоем. Дайте ему пару секунд просохнуть на воздухе. Праймер играет важную роль во всем покрытии, является как бы клеем между ногтем и базовым слоем.

Этап 3. Гель лак пошаговая инструкция

Базовое покрытие не просто так имеет такое название. С помощью базы можно не только создать основу под весь будущий маникюр, но и выровнять неровности ногтевой пластины.

  • нанесите базу тонким слоем на ноготь, не забывая запечатать торец ногтя. Можно наносить разными способами: сразу на все 5 пальцев, на 4 (без большого), или наносить и просушивать по одному пальчику. Мы рекомендуем именно последний метод, ведь таким образом материал не успевает затечь на кожу или на один бок, создавая горбы и неровности. На этом этапе и дальше после нанесения каждого слоя нужно просушивать его в лампе (УФ люминесцентной — 2 минуты, LED – 30 секунд). Ниже изображено как правильно держать руку в лампе.
  • после мук выбора цвета гель-лака можно приступать к его нанесению. Лучше всегда наносить цветник в 2-3 тонких слоя, чем в 1 толстый. Не забываем покрыть и торец ногтя. Не стоит переживать что гель-лак в один слой ложится не плотно и, возможно, даже не равномерно. Со вторым слоем все придет в норму. Одним толстым слоем вы никогда не добъетесь идеально ровного покрытия;
  • если хочется как — то разбавить однотонное покрытие, можно использовать декор, которых сейчас просто невероятное разнообразие в nail магазинах, самое время это сделать. Очень популярный дизайн, а главное простой в исполнении это зеркальная втирка;
  • топ или финиш — это самое верхнее покрытие всего этого полимерного бутерброда. Именно качественно нанесенный топ обеспечит вам стойкое покрытие на 3-4 недели. Топ можно подержать немного дольше в лампе, потому что если он плохо просохнет потеряется яркий глянец. Топ бывает с липким и без липкого слоя. Поэтому если у вас с липким, после просушки нужно протереть все той же жидкостью для обезжиривания
  • после всех этих этапов рекомендуется увлажнить кутикулу маслом и не забывать о базовом уходе за руками, но это уже тема для отдельной статьи.
Подсчеты экономии

Если вы пришли в эту статью с целью узнать как сделать маникюр гель-лаком, то наверняка вы хотите заняться этим самостоятельно. По этому мы решили привести подсчеты по затратам на все необходимые материалы и инструменты для домашнего гель лак нанесение и стоимость данной услуги в салоне красоты или nail студии.

Далее мы рассмотрим список необходимых материалов с актуальными ценами в нашем интернет-магазине.

  1. Лампа UV/LED Sun 9S 24Вт c дисплеем один из самых оптимальных вариантов для домашнего использования, к тому же за счет отсутствия дна такая лампа применима и для педикюра. Стоимость 600 грн.
  2. Маникюрные ножницы для кутикулы Сталекс (Н-05) (SC-10/3), 24 мм стоят 165 грн, для домашнего маникюра отлично подходят. Или за эти деньги можно приобрести кусачки для кутикулы.
  3. Маникюрная лопатка Zauber стоит всего 65 грн, но можно приобрести Апельсиновые палочки Kodi (10 см) 10 шт за 11 грн. Для домашнего маникюра лучше даже использовать апельсиновые палочки, потому что металлическим пушером повышается риск травмировать ногтевую пластину.
  4. Пилка Kodi Half Grey — полукруг, 180/240 отлично подойдет и для оформления свободного края (240 грит) и для запиливания покрытия при снятии старого гель-лака (180 грит). Стоит такая пилочка 18 грн.
  5. Бафик Salon Professional 240 грит — синий, брусок стоит всего 25 грн.
  6. Безворсовые салфетки TUFI Profi тканевые 5х5, 100 шт. за 15 грн, при расходе 1-2 салфетки на один маникюр, хватит на как минимум на 50 покрытий.
  7. Tufi Profi Prep&Finish — жидкость для обезжиривания, снятия липкого слоя, дегидрации, 100 мл очень универсальное и экономное средство. Применимо и для обезжиривания ногтевой пластины, и для снятия липкого слоя. Цена 40 грн.
  8. Праймер Naomi Ultrabond Primer — бескислотный, 12 мл стоит всего 60 грн, но при этом хорошего качества.
  9. Базу и Топ возьмем от бренда Kodi, они хорошо себя зарекомендовали в nail мире, а так как они в одну цену то получаем 2х135=270грн.
  10. Для наших просчетов возьмем три гель-лака от бренда TUFI Profi по 85 грн, что бы у нас был ассортимент цветов. 3х85=255грн.
  11. Масло для кутикулы вовсе не обязательное условие, но желательное, приплюсуем и его. Масло для кутикулы Naomi цветочное (апельсин), 15 мл стоит 75 грн.
  12. Ну и для снятия покрытия нам конечно же пригодятся специальная жидкость Tufi Profi — жидкость для снятия гель-лака, 250 мл, которая стоит 75 грн.

Наши подсчеты показали сумму 1 555 грн.

Средняя стоимость маникюра с покрытием гель-лака в салоне красоты стоит в пределах 400 грн (стоимость актуальна на 2018 год), многое в цене зависит от самого покрытия и статуса заведения в которое вы пришли. У начинающего мастера можно сделать маникюр и за 200 грн, но качество может не отвечать заявленному.

Итак, при затратах 400 грн каждые 3 недели (оптимально время носки покрытия), наши приобретения в сумме 1 555 грн окупятся за 4 месяца. По истечению этого срока ваш маникюр вам обходится бесплатно.

Если вдруг у вас сейчас возник вопрос о времени, которое нужно выделить на маникюр, то конечно же первое время процесс будет длиться дольше чем у мастера. Но с каждым разом качество покрытия будет увеличиваться, а с ним и скорость.

Если у вас остались или возникли вопросы после прочтения этой статьи, мы с радостью на них ответим.

На нашем ютуб канале можно посмотреть интересное видео про покрытие гель-лаком.

Статья подготовлена командой TUFISHOP, с большой любовью к читателю, с целью помочь разобраться в этом не легком вопросе.

технология пошагово и разбор ошибок

Небольшой опрос, проведенный среди мастеров ногтевого сервиса, показал удивительную статистику. На 40 с лишним процедур покрытия ногтей гель-лаком приходится только одна запись на снятие, хотя логично предположить, что счет должен быть один к одному. Увы, большинство клиенток искренне считают, что технику, как снять гель-лак, они освоят самостоятельно, и сэкономят, если сцарапают и соскребут отросшее покрытие дома. Итогом становятся те самые “испорченные гель-лаком” ногти, которые потом приходится долго лечить и восстанавливать.

Чтобы после снятия гель-лака ногти оставались такими же крепкими и здоровыми, как и до, необходимо соблюдать ряд правил:

  1. Гель-лак нельзя выковыривать и отдирать при появлении “карманов”: полимерный слой уходит с частичками натурального ногтя.
  2. Не имея навыков, нельзя спиливать покрытие пилкой, а тем более фрезой — риск сточить и ноготь слишком велик.
  3. Используемые в процедуре препараты должны быть щадящими: длительный контакт с пальцами плохо очищенных ацетатов может вызвать дерматиты и аллергии.

Как снять гель-лак правильно: материалы и инструменты

Сама процедура несложна: с ней действительно справится даже новичок, ну а с приобретением необходимых материалов поможет европейский производитель препаратов для ногтевого сервиса NeoNail:

Заранее стоит запастись и средствами для маникюра.

После снятия гель-лака ногти придется привести в порядок: снова покрыть или сделать маникюр и оставить в естественном виде.

Понадобиться могут:

Как покрыть ногти гель-лаком мы уже рассказывали ранее: можно воспользоваться этим мастер-классом.

Удаляем гель-лак: инструкция по шагам

Гель-лаки разных марок ведут себя индивидуально: качественные составы NeoNail растворяются легко. При использовании мягкой жидкости NeoNail удаление гель-лака пройдет быстро и щадяще. Техника выполнения:

Мягким шлифовщиком снимаем верхний слой, это позволит жидкости быстрее впитаться в покрытие и разбить его изнутри.
На спонж капаем жидкость для растворения гель-лака: он должен хорошо пропитаться.
Прикладываем спож к ногтю и заворачиваем полоской фольги. Плотная лента хорошо обнимает ноготь и отлично держится, создавая необходимый “эффект парника”.

Повторяем процедуру на 10 ногтях и ждем 15 минут. Важно: снимаем фольгу только непосредственно перед удалением гель-лака по 1 ногтю: структура снова начнет затвердевать, попав на воздух.
Быстро стягиваем “колпачок” из фольги с пальца и палочкой или пушером удаляем размокший гель-лак. Давить на палочку, царапать и отдирать слои нельзя. Если покрытие не ушло сразу, заворачиваем повторно: для некоторых азиатских марок эта процедура вынужденная. Качественный продукт повторного заворачивания не потребует, поэтому ожога кожи пальцев и ногтевого ложа не произойдет.

Окончательно зачищаем ноготь мягким шлифовщиком.

Если мастер планирует снова нанести гель-лак, то полировка не делается. Если есть желание полечить ногтевой аппарат, то разобравшись, как снять гель-лак, стоит познакомиться с техникой выполнения европейского маникюра. Эта процедура и материалы NeoNail позволят отрастить действительно крепкие и красивые натуральные ногти.

покрытие в домашних условиях, как правильно наносить, технология, поэтапное объяснение

Красивый, яркий, и главное, стойкий маникюр – это то, о чем мечтают многие женщины.

Но зачастую покрытие отслаивается с ногтей в течение двух или трех дней. Но так было раньше. Сейчас все имеют возможность выполнить маникюр гель-лаком, который позволит создать яркий, красивый и очень стойкий нейл-арт ноготков на свой вкус.

Особенности покрытия

Маникюр ноготков с использованием гель-лака с каждым днем становится все более популярным. Он позволяет сделать красивый, стойкий маникюр даже самостоятельно у себя дома. К тому же в отличие от наращивания ногтей или покрытия их акрилом, гель-лак является более безопасным для структуры ноготков. Многообразие оттенков, возможность нанесения рисунка или страз поверх этого покрытия дают возможность создать маникюр на любой вкус и случай жизни.

Главная особенность гель-лака заключается в его долговечности и отсутствии у него такого дефекта, как растрескивание на поверхности ногтя. Поэтому можно не бояться за сохранность своего маникюра и смело заниматься такими бытовыми делами, как стирка, мытье посуды и влажная уборка.

Являясь противоположностью стандартных лаков и акрилового покрытия, это средство не только не травмирует ногти, но еще и способствует их укреплению и усилению роста. Поэтому такой вид нейл-арта идеально подойдет женщинам с тонкими и ломкими ноготочками.

Также такое покрытие станет лучшим выбором для тех, кто любит яркий и красивый маникюр, но не может или не хочет каждый день выполнять его самостоятельно. Уникальная формула этого средства позволяет ему сохранить яркость красок, их блеск и сохранность на ногтях на протяжении более 14 дней.

Поэтому такой дизайн ногтей прекрасно подходит и тем, кто отправляется в отпуск или в длительную командировку.

Но, пожалуй, самой важной особенностью гель-лака является необходимость использования специфического оборудования при его применении.

Сам процесс покрытия им ноготков не является сложным, но может стать полностью невозможным из-за отсутствия необходимых инструментов. Поэтому перед тем, как приступать непосредственно к маникюру, следует заранее приобрести все необходимые атрибуты.

Советы для начинающих

Тем, кто решил попробовать самостоятельно делать маникюр с гель-лаком, необходимо запастись необходимым оборудованием, и в первую очередь это касается специальных ультрафиолетовых ламп. В продаже имеются две разновидности такой лампы — УФ и LED. Новичкам лучше всего отдать предпочтение первому варианту, так как он имеет меньшую стоимость и более прост в эксплуатации.

Также понадобятся специальные пилочки различных размеров и специальная пилка для шлифования ногтевой пластины – баф. Помимо самого гель-лака различных оттенков, потребуется еще специальная основа и закрепитель. Особое внимание уделить необходимо тому, чтобы эти два средства были предназначены именно для гелевого покрытия, те, которые используются для наращивания ногтей не подходят. После их использования гель-лак начинает растрескиваться уже через несколько часов. В крайнем случае, можно покрыть гель обычным бесцветным лаком, но в этом случае рассчитывать на длительную стойкость маникюра не следует.

А еще понадобятся и такие комплектующие, как специальные безворсовые ватные диски или салфетки, обезжириватели, палочки из апельсинового дерева и смягчающий крем или масло для кутикулы.

Но мало приобрести все необходимые инструменты, необходимо научиться ими правильно пользоваться.

В первую очередь, необходимо пройти специальное обучение. Именно подготовка к дальнейшей работе играет важную роль. От того, насколько правильно будет выполняться маникюр, зависит не только его внешний вид и стойкость, но и мнение о вас как о специалисте.

Сделать это можно как на специализированных курсах, так и попросив хорошего специалиста показать вам мастер класс. А еще лучше периодически брать частные уроки, так можно избежать многих проблем в работе и в случае необходимости сразу получить компетентную помощь. Сама по себе инструкция по работе с гель-лаком очень проста, все этапы доступны, понятны и подробно расписаны, но лучше все же один раз увидеть, чем несколько раз прочитать или услышать.

Немаловажную роль в работе играет и опрятность как самого мастера, так и его рабочей зоны. Поэтому очень важно, чтобы на вашем рабочем столе всегда был идеальный порядок. Первое впечатление — самое главное, даже если планируется делать маникюр лишь себе и своим знакомым.

Простое покрытие гель-лаком ногтей одного цвета быстро надоедает. Поэтому рекомендуется постоянно совершенствовать свой профессионализм. Самый простой способ заключается в приобретении специальных наклеек, страз и трафаретов для создания рисунков и узоров.

Опытные мастера маникюра настоятельно рекомендуют всем новичкам, даже тем, кто планирует делать покрытие гель-лаком исключительно себе, создавать портфолио своих работ.

Это позволит наглядно увидеть прогресс своей деятельности или разглядеть некоторые ошибки.

К тому же в будущем это позволит предоставить клиенту наглядный выбор возможного дизайна ногтей.

Как наносить в домашних условиях

Но научиться качественно, красиво, правильно и аккуратно покрывать ногти гель-лаком можно, только регулярно практикуясь. Поэтому в первую очередь необходимо подробно разобраться в том, как правильно красить ногти гель-лаком дома самостоятельно.

Делать маникюр собственными руками, не покидая стен дома, можно двумя способами. Они различаются используемыми материалами и видом лампы. В первом случае для выполнения маникюра понадобится пилка, баф, основа и топовое покрытие, лама УФ, гель-лак нужного оттенка, обезжириватель и дезинфикатор. Во втором случае используются аналогичные инструменты, но к ним добавляется еще и праймер, а УФ-лампа заменяется на лампу LED.

Инструкция первого способа содержит в себе следующие этапы:

  1. Подпиливание края ногтя для придания ему необходимой ровной формы и удаление с его поверхности кератинового слоя при помощи обычной пилки и пилки баф. Использовать баф необходимо с осторожностью, достаточно сделать лишь несколько движений этим инструментом для удаления блеска с поверхности ноготков. Это необходимо для лучшего скрепления покрытия с ногтем.
  2. Затем необходимо обрезать кутикулу, используя специальные щипчики.
  3. Обезжиривание ногтевого ложа является обязательным этапом в маникюре с гель-лаком.
  4. После этого поверхность ногтевого ложа покрывается специальной гелиевой основой. Лучше всего наносить ее на каждый пальчик и просушивать в лампе. В УФ время просушки составляет две минуты.
  5. После этого на высохшие ногти наносится тонким слоем выбранный оттенок гель-лака. Обратите особое внимание, что первый слой должен быть полупрозрачным. Наносить также рекомендуем на каждый пальчик поочереди, и каждый следующий нужно красить после высыхания предыдущего.
  6. Наносим второй слой гель-лака, который должен быть гораздо толще первого. Также просушиваем кончики пальчиков в УФ-лампе.
  7. В заключении на все ноготки обязательно наносится топовое покрытие, которое должно покрывать и торец ноготков. Оно также должно полностью просохнуть под ультрафиолетовыми лучами. По истечению времени липкий слой с ногтя удаляется при помощи дезинфикатора.

Если говорить о втором способе выполнения маникюра в домашних условиях, то последовательность действий является аналогичной вышеописанному способу. Разница заключается в двух вещах:

  • После обезжиривания ногтевого ложа на него сначала наносят праймер, который просушивают в лампе, и лишь уже после наносят основу под гель-лак. Дальнейшая техника маникюра выполняется также пошагово, как и в первом способе.
  • В отличие от ультрафиолетовой лампы, лампа LED позволяет просушить покрытие не за две минуты, а всего лишь за 15-20 секунд, что позволяет существенно сократить время процедуры.

Хотя и в первом варианте выполнения маникюра может использоваться и лампа LED. Здесь все зависит от материальных возможностей и личных предпочтений. Технология выполнения маникюра с гель-лаком не подразумевает под собой обязательное использование праймера. Но опытные мастера говорят о том, что именно это средство позволяет продлить жизнь маникюру и положительно влияет на ногти.

Выполняя маникюр поэтапно, вы можете добавить и некоторые свои изменения.

Так, например, перед нанесением топового покрытия можно украсить свои ноготки цветными нитями, стразами или любым рисунком. При этом надо помнить, что наносить дополнительные украшения можно только после высыхания гель-лака в лампе.

После украшения ноготков их необходимо особо тщательно покрыть закрепителем, чтобы зафиксировать элементы на ноготках и просушить в лампе около трех минут или 30 секунд, здесь все зависит от ее разновидности.

Делая маникюр гель-лаком, нужно уделить особое внимание аккуратности нанесения всех видов покрытия на ногти. Стоит внимательно следить за тем, чтобы гель-лак или закрепитель не попали на кожные валики вокруг ноготков и кутикулу. Во-первых, они смогут спровоцировать появление раздражения или аллергической реакции, а во-вторых, такой маникюр будет смотреться неопрятно и небрежно.

Как сделать маникюр гель-лаком в домашних условиях смотрите в видео ниже.

Но сделать нейл-арт с использованием этого средтва — это лишь половина дела. Рано или поздно его необходимо будет удалять с ногтевой пластины.

Правила снятия

Эту разновидность покрытия для ноготков нельзя снять так же, как обычный лак для ногтей. Некоторые мастера удаляют его с ноготков при помощи пилки, то есть спиливают, как и акриловое покрытие или нарощенные ногти.

Но это абсолютно неправильно. Во-первых, это пустая трата времени, а во-вторых, такая процедура способна существенно повредить ногти.

Для удаления гель-лака с поверхности ногтей можно использовать специальный очищающий раствор, который можно приобрести сразу в комплекте с гелем. А можно воспользоваться и обычной жидкостью для снятия лака, но при условии, что в своем составе она содержит ацетон.

Помимо самой жидкости, потребуются еще и диски из ваты или шарики, палочки из апельсинового дерева, а также обычная кухонная фольга.

Диски обильно смачиваются в выбранном растворе и плотно прикладываются к кончикам пальцев, а сверху обматываются фольгой. В таком положении руки находятся в среднем 20 минут. Если использовалось специальное средство, то время его воздействия на гель-лак — 15 минут. Если применялась обычная жидкость для снятия лака, то ее необходимо оставить на ногтях на полчаса.

Затем фольга с ваткой удаляется с кончиков пальцев. Ногтевое покрытие, находящееся под ними, должно сильно раздуться и приподняться над поверхностью самого ноготка. При помощи апельсиновой палочки аккуратно приподнимаем его до конца и продвигаем к краю ногтя, затем полностью удаляем. Под воздействием жидкости лак превращается в тонкую пленочку, которая легко и просто удаляется с поверхности ногтя, не травмируя его.

Конечно, следует понимать, что чем дольше это средство находилось на поверхности ноготков, тем сложнее его будет удалять, и процедура может занять гораздо больше времени. Поэтому оптимальным временным промежутком между нанесением этого покрытия и его удалением считается 14 дней.

После снятия гель-лака необходимо дать ногтям отдохнуть хотя бы пару дней.

Лучше всего сделать специальные травяные ванночки или ванночки с морской солью, это поможет им быстрее восстановиться после проведенной процедуры.

Мастер-классы

Используя гель-лак, можно создать маникюр в любом стиле и цвете. А для того, чтобы не пришлось ломать голову и искать наиболее подходящие варианты, мы подготовили для вас 3 мастер-класса по дизайну ногтей гель-лаком. Среди них вы обязательно сможете подобрать для себя наиболее подходящий вариант.

Первый мастер-класс поможет вам создать самый элегантный и популярный во все времена французский маникюр. Вы можете выбрать не только классические цвета для этого дизайна, но и любые другие на свой вкус.

  1. Подготовьте лампу, баф, пилку для ногтей, грунтовочное средство, праймер, основу, гель-лак двух выбранных оттенков, закрепитель, дезинфектор, ватные диски и специальные полоски для французского маникюра.
  2. Подпиливаем края ногтей и обрабатываем их поверхность бафом.
  3. Наносим праймер в один слой и отправляем ногти в лампу на 2 минуты или 10 секунд, все зависит от ее вида.
  4. Покрываем всю поверхность ноготков, включая торец, основой под гель-лак, а на кончики ноготков наносим тонким слоем грунтовочное средство. Отправляем ноготки по очереди в лампу на аналогичный промежуток времени.
  5. Наносим на всю длину ноготков гель-лак базового оттенка в два слоя. Не забывайте о том, что второй слой можно наносить лишь после высыхания первого.
  6. Приклеиваем к ногтям специальные полосочки, которым ограничиваем зону окраски вторым оттенком. Закрашиваем кончики ноготков вторым, более темным цветом, опять же в два слоя, отправляя каждый раз руки в лампу.
  7. В заключение покрываем все ногти закрепителем, просушиваем их в лампе и удаляем липкий слой при помощи дезинфектора.

Ваш французский маникюр, выполненный собственноручно у себя дома и в любимых вами тонах, готов.

3 способа нанесения французского маникюра гель лаком смотрите в видео ниже.

Любительницам страз и блесток обязательно должен понравиться стеганый маникюр. А как его выполнить самостоятельно, вам расскажет следующий мастер-класс:

  • Подготовьте стразы, специальный супер-клей, гель-лак светлого оттенка, обезжириватель, основу, закрепитель, лампу, маникюрную нить, пилку и баф.
  • Подготовьте ногти к покрытию при помощи тех же инструментов, что и в предыдущем мастер-классе.
  • Нанесите на ноготки слой основы и отправьте в лампу на 30 секунд или одну минуту.
  • Снимаем липкий слой и раскладываем по всей поверхности ногтей маникюрную нить в желаемом порядке.
  • На всю поверхность ногтя нанесите последовательно два слоя выбранного гель-лака. Просушивая каждый из них по две минуты или 30 секунд в лампе.
  • Убираем нити с ногтя и наносим на его поверхность маленькие капли клея туда, где планируется наносить стразы.
  • Накладываем украшения на супер-клей, слегка прижимая их.
  • В заключении наносим закрепитель и отправляем ноготки сушиться еще на две минуты.

Красивый переливающийся стеганый маникюр готов. Можно наносить блестки не на каждый ноготь, а лишь на несколько. Это же касается и нанесения узора при помощи нитей.

Как сделать стеганый маникюр гель лаком смотрите в видео ниже.

Большой популярностью пользуется и так называемый частичный маникюр. Он заключается в том, что 3-4 ноготка на руке окрашиваются гель-лаком одного тона, а оставшиеся украшаются по собственному желанию — можно использовать наклейки, можно создать любой рисунок или позаимствовать элементы стеганого маникюра. Сделать такой нейл-арт очень легко.

  1. Подготовьте лампу, пилку, баф, обезжириватель, закрепитель, основу, праймер, гель-лак, наклейки с узорами, дезифектор.
  2. Подготовьте ноготки к процедуре, как и в двух предыдущих случаях.
  3. После обезжиривания ноготков нанесите на них праймер и отправьте в лампу на 2 минуты. При выполнении этого маникюра каждый слой средства должен сушиться две минуты или 30 секунд в лампе.
  4. Наносим основу под гель-лак на все ноготки и сушим.
  5. Далее наносим гель-лак на все ноготки, кроме безымянного пальца на одной руке, а также мизинца и среднего пальца на другой руке. Просушиваем в лампе.
  6. Приклеиваем к не накрашенным ноготкам подготовленные наклейки. Они могут быть цветными, черно-белыми, с изображением цветов и так далее. Все зависит от вашего вкуса. Покрываем все ногти закрепителем и отправляем в лампу.
  7. Удаляем липкий слой дезифектором.

Ваш яркий и индивидуальный маникюр готов. При наличии должных навыков и терпения можно заменить наклейки любыми собственным рисунком или стразами. Такой маникюр всегда привлекает к себе внимание, а в зависимости от выбранного оттенка подойдет для любого случая и образа.

Техника нанесения налейки-слайдера в маникюре гель лаком — в видео ниже.

Маникюр с использованием гель-лака может быть любым: ярким и незаметным, классическим и бунтарским, но одного у него не отнять — это стойкость, яркость цвета и простота исполнения.

Можно ли наносить гель-лак без базы?


База для гель — лака – это универсальное средство, которое предназначено для первоначального покрытия ногтевой пластины, обеспечивающее лучшее дальнейшее сцепление материала с поверхностью ногтей. В этой статье мы разберемся в чем же ее особенность и почему она так необходима каждому мастеру.

Какую роль играет база?


База является залогом хорошего и стойкого маникюра. Она предназначена для обеспечения наилучшего сцепления гель-лака с поверхностью ногтевой пластины. База защищает возможное негативное воздействие гель-лаков на естественную структуру ногтя. Как правило, она не имеет цвета, хорошо ложится на ноготь, выравнивая и немного укрепляя его. Некоторые производители создают каучуковые базы, которые имеют большую вязкость и заменяют процедуру укрепления ногтей гелем. Каучуковые базы плотнее обычных баз, но предназначение имеют все то же – обеспечение наилучшего сцепления гель-лака с поверхностью ногтя и защита от негативных воздействий компонентов продукта. Некоторые базы имеют небольшие оттенки розового и бежевого тонов. Мастера могут использовать базу как самостоятельное покрытие, не требующее дополнительного нанесения поверх цветного лака.

Можно ли наносить гель без базы?


Если мы говорим о трехфазной системе гель-лаков, то ответ очевиден – нет.

База и гель-лак – это два неразлучных продукта, которые по отдельности очень плохо взаимодействуют с поверхностью ногтевой пластины. Без базы покрытие гель-лаком продержится около 2-3 дней, так как материал будет недостаточно «схвачен» с ногтями. Нанесение базы обеспечит стойкое и красивое покрытие около 2-4 недель. Завершается трехфазная система нанесением специального закрепляющего средства – топа, без которого покрытие тоже «слезет» раньше времени.


Однако современные технологии дошли до превосходной степени. На рынках появляются все новые и новые продукты, позволяющие заметно облегчить проведение процедур.


Однофазная система гель-лаков – это система, позволяющая выполнять маникюр при использовании одного лишь продукта. Во флаконе содержится и база, и цвет, и завершающее топовое покрытие. Этот экспресс — вариант хоть и заметно сокращает время работы, но оставляет за собой большой недостаток – он имеет меньшую износостойкость, нежели обычное трехфазное покрытие.


Техника нанесения гель-лака очень проста. Она требует не столько навыков и знаний, сколько аккуратности и большой внимательности и усидчивости. Первые работы могут получаться не аккуратными, но это всего лишь дело времени, техники и наработки опыта. Зная определенные правила, процедура гель-лака оказывается по силам любому мастеру, решившему развиваться в данном направлении.

Правила нанесения гель-лака.

  1. Первым делом необходимо обработать поверхность ногтей, сделать обрезной или классический аппаратный маникюр, пройтись по поверхности ногтей специальным бафом, позволяющим отшлифовать ногтевую пластину.
  2. Далее ноготь обезжиривают специальным средством и наносят базу под гель-лак.
  3. Следующим этапом идет нанесение цветного гель-лака и создания дизайна на ногтях. Этот этап занимает самое большое время во всей процедуре, так как требует качественного нанесения материала и хорошей просушки в УФ-лампе.
  4. После нанесения цвета необходимо закрепить результат последним покрытием – топом, обеспечивающим защиту всего материала от воздействий окружающей среды.


Гель – лак – это очень популярная процедура среди девушек, которые желают сделать свои ногти красивыми и ухоженными. Для того, чтобы маникюр радовал вас долгое время, необходимо тщательно выбирать мастера, который использует в своей работе только лучшие материалы.

Как наносить гель-лак на палитру

Магазин Nail Art Shop
Балашиха, Шоссе Энтузиастов 5б
+7 967 011-30-75

Палитра для гель-лаков — это набор типсов, на которые можно наносить покрытие для его лучшей презентации. Именно по этой палитре можно определить, как гель-лак будет смотреться на ногтях. Материал типсов может быть прозрачным или нет, это также влияет на передачу цвета. Как наносить гель-лак на палитру и на что обратить внимание при этом — читайте в статье.

Для чего предназначены палитры и какими они бывают?

Палитра позволяет мастеру помочь клиенту с выбором оттенка, предложить несколько похожих цветов, если сложно определиться. По описанию цвета на упаковке это сделать нереально, поэтому такие наглядные приспособления просто необходимы. Если маникюр состоит из нескольких цветов, палитра поможет сравнить их и посмотреть, насколько хорошее сочетание получается из них. Она является настоящей палочкой-выручалочкой для специалистов ногтевого сервиса. Для ее создания важно знать, как нанести гель лак на палитру.

Возможные формы приспособления

Приспособление может иметь разную форму, складываться. Оптимальный вариант — “ромашка”.

Вы можете прикладывать типсы к ногтю, чтобы смотреть, как выглядит наиболее приятно. Оттенки удобно просматривать и перемещать. Веерная палитра также является довольно компактной и удобной, на ней хорошо показывать различные узоры и варианты декора. Прямоугольная палитра не очень удобна для выбора цветов, так как они расположены рядом с друг другом, их нельзя приложить к ногтю, а оттенки могут сливаться. Если вы используете гели или шеллак, как наносить на палитру — читайте ниже.
Как нанести оттенок на палитру?

Как сделать палитру гель лаков? В целом, технология очень сходна с обычным покрытием ногтей, есть только некоторые особенности. Рассмотрим их более внимательно:

  • перед тем, как покрыть палитру гель лаком, типсы необходимо обезжирить — это повысит сцепление покрытия с поверхностью, гель-лак будет держаться на них долго, обеспечит частое использование палитры;
  • не переживайте за состояние пластика после воздействия сушки — УФ-лампа не повредит материал, а только закрепит покрытие. Впрочем, как и при нанесении покрытия на ногти;
  • наносить ли базу? Тут есть два варианта: если вы хотите менять покрытие на палитре в будущем — лучше используйте полноценный комплекс из всех этапов покрытия, если нет — может сэкономить и нанести только цветной слой;
  • как определить, сколько слоев покрытия наносить? Ориентируйтесь по ситуации: если один слой выглядит насыщенно и плотно — этого достаточно, а если сквозь него просвечивает пластик, есть полосы — лучше покройте типс еще раз;
  • нанесение топового слоя улучшает визуальные качества палитры, придает покрытию блеск и максимально точно передает, как будут выглядеть ногти после процедуры.

Подготовка палитры не займет много времени и сил — наоборот это увлекательный процесс, который позволит поближе познакомиться с разными видами покрытий, понять, как их лучше наносить на ногти. Вы можете создать плавный переход цветов от светлых к насыщенным или сгруппировать лаки по оттенкам — это зависит от вашего вкуса и фантазии.

Пошаговое руководство по гель-лаку Perfect Match, верхнему покрытию, гель-краске и многому другому

Слух верен! Официально весна! Также официально принято, что люди собираются сидеть, смотреть на ногти, а затем (надеюсь) идти в ванную и наносить полный слой лака для ногтей. Если так с весной справишься? Отличная работа! Вы фантастический, вдохновляющий маникюр!

Независимо от того, есть ли у вас время на часовое погружение ногтей или ваши клиенты не заботятся о дневном уходе за ногтями, тем не менее, доступ к первоклассным тискам для лака — это столько же инвестиций, сколько и на следующий день. Педикюр.Хотя в Интернете можно найти так много советов (и по бесплатной или по очень низкой цене), мы нашли время, чтобы выбрать наши любимые советы по выбору лучших ногтей каждый раз!

1. Масло для ключей Linger

Знаете ли вы, что продолжать наносить лак или средство для ухода за кутикулой после пребывания на солнце — это здорово? Разрыхляющие масла, например масла на масляной основе, могут помочь сохранить цвет дольше и избавить от ощущения впитывания. (Так хорошо, если вы чувствуете разочарование!) Вы также можете натереть кончики маслом перед нанесением базового слоя — влага, создаваемая маслом, поможет лаку дольше выглядеть и покрыть больше ногтей.Кроме того, есть еще лучшие масла для ухода за телом на масляной основе!

2. Следите за ингредиентами

Свежий, свежий цвет! Большинство продуктов содержат большое количество химикатов. Тем не менее, ищите надписи «не использовать» и «запрещено», особенно в брендах, которые во много раз превосходят свой лак. Если на продукте написано без запаха, он не будет пахнуть по-другому, когда вы его используете.

3. Возродите польский чай с чжэцзянским чаем

Предостережение для тех, кто использует ароматизированные лосьоны, чтобы добавить яркости своему базовому слою: это может сделать ваш лак слишком непривычным, а также усилить воздействие солнечных лучей.

Если у вас есть пара лишних ароматных лосьонов под рукой, нанесите их на левый и правый ногти и — вуаля! Гель для натурального стиля!

4. Сделайте смешивающую смесь

Нам всем нужно немного цвета — хотим мы этого в своем лаке или нет! Смешайте базовое и верхнее покрытие, чтобы получился цвет на ночь. Кроме того, если вы нанесете только один слой базового покрытия и один слой верхнего покрытия, вы в конечном итоге получите тонну продукта! Так что в следующий раз, когда вы пойдете в ванную с влажным и тонким лаком, вы получите желаемую текстуру и однородность цвета!

5.Запас Zinger

Зингеры наконец-то здесь! Если вам нравится внешний вид глянцевого лака, смешайте его со связующим. Вы можете найти блестки, базовые покрытия с блестками или верхние покрытия с блестками на Amazon или в Интернете — сочетание делает любой натуральный ноготь ярче!

6. Эффект радуги

Есть несколько советов по нанесению бледных тонов, а есть советы по нанесению тёмных оттенков металлик и пастели. Поскольку текстура и консистенция являются важными факторами при размещении цвета, используйте ее более глубокого оттенка, чтобы избежать скучного вида.

7. Мерло Уход за кожей

Если у вас нет с собой цветного карандаша, мы рекомендуем купить его в универмаге, таком как Nordstrom, и добавить простой глянец или сухой глянец, чтобы получить большую яркую линию улыбки! Также важно убедиться, что ваше платье для погружения хорошо пахнет, прежде чем наносить гелькоут — украсьте свои бренды сухим цветком, чтобы освежить запах.

8. Нанесите верхний слой после нанесения смазки

Говорят, что лучший способ по-настоящему подготовить руки — это покрыть ногти перед тем, как мыть их, а не после мытья.Это потому, что таким образом вы предотвратите влажность и морщинистость рук, а также придадите ногтям максимально однородный цвет и блеск.

9. Используйте верхнее покрытие, когда все остальное работает в обычном порядке

Теперь, когда вы знаете, как наносить верхнее покрытие, попробуйте использовать пигментную часть верхнего покрытия для улучшения любого цвета, но всегда делайте это как практическое правило, а не как конкретную вещь.

Верхнее покрытие не повреждает, не обнаруживает пятен и внутренних масел.

10. Пушистые ноты

Если вы хотите получить удовольствие от верхнего покрытия, присыпьте его ворсом и пылью.Более смелый тон или более изысканная нота могут работать лучше всего, но главное — каждый раз пробовать что-то новое.

11. Поменяйте местами

При использовании верхнего покрытия подумайте о том, чтобы использовать контрастный цвет, а не основу. Это поможет выделить цвет ваших ногтей.

12. Нанесите верхнее покрытие в качестве основы

Маслообменник, используемый для нормализации любого некачественного покрытия, может растворяться по мере истирания верхнего слоя. Нанесите прозрачный верхний слой, когда ваша основа станет сливаться с цветом ваших ногтей.Идеально использовать яркий светлый цвет с более низким тоном.

13. Шаг байпаса 2

Если у вас нет времени ждать, пока масло подойдет, вы можете использовать это как ярлык. Нанесите прозрачный верхний слой в качестве основы. Подождите, пока ваш цвет начнет переходить на второй слой, возьмите лак, как только вы достигнете точки загустения, и второй слой сделает тяжелую работу.

14. Выбирайте цвет с умом

Не бойтесь попробовать гель-лак в широкой цветовой гамме.Всегда полезно достать кисть перед нанесением первого базового слоя, чтобы проверить, хорошо ли он работает.

15. Попробуйте распыление

Распыление готового базового покрытия на пальцы дает вам больше контроля над выбором цвета. Кроме того, приготовьте базовый слой того же цвета, что и верхний слой.

16. Безопасная игра

Никогда не пробуйте слишком много солнцезащитных кремов одновременно. Если у вас есть выбор, выбирайте легкие и износостойкие лаки для лета и выгорания в холодные месяцы.

15 лучших советов по окраске ногтей

Блестящий и гладкий, белый, матовый, оттенок. Правильно выбрав средство для макияжа или косметику, вы сможете быстро и легко создать великолепный вид ногтей.

Эта статья была опубликована Салли Хансен, Сеть косметических и маникюрных товаров. Следуйте за нами в Twitter по адресу: @BeautyNowCEN.

Отметьте 15-летие этого еженедельного сайта, поделившись с друзьями! Войдите в систему: http: //cen.digitalhealthcup…

Поделитесь своими изображениями он [адрес электронной почты]

№ 10.Нанесите лак для ногтей Perfect Match с помощью острого инструмента (для удаления белых пятен) или пилки для ногтей, ручки или аппликатора для губки.

В прохладный день можно нанести белый базовый слой горячей кистью. Затем с помощью щетки для кожи нанесите пастельный цвет более светлым тоном.

Минимальная щетина на щетке помогает избежать намокания глянцевой краски на ногтях. Кроме того, они впускают больше воздуха в цвет макияжа, который сходится с цветом ваших ногтей.

RATHER: Поделитесь как часть группы: #PaintMagically!

№ 9.Придерживайтесь простой техники ретуши.

Используйте кисточку для дизайна ногтей или ватные палочки, чтобы закрепить лак на искусственных ногтях, чтобы добиться максимальной долговечности.

Покройте верхнюю половину ногтя кремово-белым гель-лаком. Затем нанесите верхнее гелевое покрытие мягкими светлыми ватными палочками на другую половину.

Купите распылитель с водой и блестками для более удивительного результата.

№8. Если вы отвечаете за творческую кампанию, то ваша она должна быть идеального цвета, подходящего к остальному макияжу и ногтям.

Мы предлагаем аппликатор в форме полумесяца для обоих цветов, которые вы пытаетесь сочетать.

Цвет гелевой основы должен быть прохладным для вашего тона кожи.

Используйте салфетку или салфетку для рук, чтобы нанести верхнее покрытие, чтобы лак для ногтей выглядел так же свежо, как и вы.

№ 7. Рассмотрите возможность нанесения гель-лака мгновенно.

Один из самых красивых наборов ногтей, который вы когда-либо носили, — это мгновенный набор гель-лака.

В наши дни существует несколько форм гелевой жидкости, которые люди любят использовать:

— Состав геля: Эти зелья созданы путем смешивания жидкого геля с эмульгирующим агентом, таким как хинин, лимон или масло из семян лайма.При смешивании получается гель-лак, но он высыхает дольше, чем обычный лак.

— усовершенствованное нанесение геля: обычно это временные методы нанесения гелевого лака или даже гели, которые можно нанести на губку, ватные палочки или мелкоячеистую ручку для дизайна ногтей.

Что означает использование всех трех тактик одновременно?

Новые разработки. Старые конструкции. Гель-лак выглядит почти как длинный, многослойный гель-лак.

Что делает гель-лак стойким?

Никаких масел для отверждения (например, гель-лака) не требуется, цвет не смывается и не создает пятен.

Думайте об этих комбинациях геля и резины как о холсте для ваших художественных навыков.

№6. Выбирая гель-лак, обязательно используйте продукты, не содержащие масла, без отдушек и красителей, иначе вы создадите неоновые оттенки, громкие пики и мех.

Поскольку гель-лак жидкий, невозможно наносить только один цвет за раз, и вы не можете рисовать слоями, поэтому вам нужно начинать с самого начала.

Плюс, если вы хотите продлить срок службы лака с помощью сухого порошка, важно избегать использования подходящих продуктов.

Также лучше выбрать жидкую краску, которая вступает в реакцию с безмасляными ручками для дизайна ногтей или рассыпчатым гелем.

При использовании гель-лака кисточкой для полировки нельзя акцентировать внимание на краях, поэтому нужно сразу очистить верх. Это включает в себя оттягивание кисти назад, чтобы избежать серьезных царапин, которые впоследствии могут вызвать проблемы.

Купите гелевую косметическую кисть с тремя скоростями или завитками для более мягких штрихов.

№ 5. Решите, как вы хотите смыть лак.

Прежде чем беспокоиться о замене цвета, убедитесь, что пятно было смыто.

Помните: алкоголь не остановит кровотечение желтого цвета, поэтому немедленно держите его в посуде.

Не звоните, пока моете ноготь.

Для быстрого удаления некрасивых пятен или блесток нанесите губку-аппликатор с мягким очищающим средством, например Cetaphil.

Затем используйте клей и масло для кутикулы

Elysian — это роскошный современный бутик в центре Хьюстона. Каждый дюйм нашего салона тщательно создан и украшен с целью обеспечить глубокое расслабление и максимальное эстетическое удовлетворение.

Запишитесь на прием онлайн сегодня!

Советы по гелевому маникюру своими руками — как сделать гелевый маникюр в домашних условиях * БЕЗ * УФ-излучения

Этот пост может содержать партнерские ссылки, что означает, что я получаю комиссию, если вы решите совершать покупки по ссылкам, которые я предоставляю (без дополнительных затрат для вас). Как партнер Amazon я зарабатываю на соответствующих покупках.

Обычно я делаю гель-маникюр в салоне красоты — это ОДНА «красавица», которую я регулярно делаю для себя… когда мы не в пандемии;).За последние несколько месяцев мне пришлось проявить творческий подход к своим ногтям, и я рада сообщить, что открыла для себя процесс гелевого маникюра LEGIT DIY (найденный с помощью Mint Arrow) БЕЗ УФ-лампы. Поверьте, если я могу это сделать, вы справитесь.

Даже когда я смогла пойти в салон на маникюр, я НЕНАВИГАЛА класть руки под ультрафиолетовый свет, поэтому я СУПЕР счастлива, что эти гелевые ногти своими руками не используют ультрафиолетовый свет :).

Вот материалы, которые вам понадобятся, шаги, которым я следую, и несколько советов по гелевому маникюру своими руками:

Принадлежности для гель-маникюра DIY at Home

  1. Кусачки для ногтей — я использую своих детей!
  2. Buffer / File
  3. Cuticle Pusher
  4. Cuticle Trimmer
  5. Gelous Base Coat — это то, что делает ваш маникюр «гелевым»
  6. Любой ОБЫЧНЫЙ цвет ногтей (не гель!) — моя подпись — Funny Bunny от OPI (опять же, обычный, а не гель)
  7. Top Coat — дает отличный блеск
  8. Средство для снятия лака
  9. Кисть для снятия лака
  10. Круглые хлопковые кружки

Это моя домашняя команда мечты Mani 🙂

Гелевые ногти своими руками: следуйте моему пошаговому руководству по созданию гелевых ногтей своими руками

Это довольно просто, обещаю!

Шаг первый — Подготовьте ногти
  • Удалите весь лак с ногтей — я использую ватную кружку с этим средством для снятия лака.
  • Подстригите ногти до нужной длины — я всегда КОРОТКИЙ!
  • Используйте напильник, чтобы придать им форму и сгладить.
  • Отполируйте их, чтобы разгладить ногтевое ложе и подготовить его к полировке.
  • Смочите ногти теплой водой и надавите на кутикулы с помощью толкателя для кутикулы.
  • Обрежьте кутикулы маленьким триммером.

вот мои голые ногти, подготовленные и готовые к покраске

Шаг второй — Покрасьте ногти

Покраска ногтей — самая легкая часть … просто замените:

Я не устанавливаю таймер или что-то в этом роде, я просто наношу краску как можно тоньше и медленно двигаюсь, чередуя руки.К тому времени, как я нарисовал одну руку, другая уже готова к нанесению следующего слоя.

краска ВКЛЮЧЕНА, но им нужен следующий шаг…

Шаг третий — очистите их

С помощью крошечной кисточки, смоченной в жидкости для снятия лака, зафиксируйте место попадания лака на кутикулу или пальцы. Этот шаг действительно имеет большое значение!

вуаля! отличный домашний гель мани

ссылка на мои браслеты — используйте код LOVELYLUCK15 для 15% скидки

Советы по гелевому маникюру своими руками

  • Выполняйте гелевый маникюр, когда у вас есть около 30-45 минут без перерыва — он же, когда ваших детей нет рядом;).
  • Go SLOW
  • Используйте suuuuper тонкие слои лака и подождите около 2 минут между слоями

Как удалить гелевые ногти в домашних условиях

Также нравится, что вам не нужно соскребать этот гель с ногтей, как в салоне красоты. Просто нанесите обычную жидкость для снятия лака на ватный диск или ватный диск, и он сразу же исчезнет!

Вот и все! Типичного домашнего гелевого маникюра у меня хватает примерно на 2 недели, что неплохо для рукоделия! Нужны еще лайфхаки для карантина? Прочтите этот пост, если у вас есть дети :).

Если вы хотите сделать домашний гель-маникюр со светодиодной подсветкой, у моей подруги Крисси есть отличный вариант!

Есть вопросы о том, как сделать гель-маникюр своими руками в домашних условиях? Оставляйте их в комментариях!

как сделать гелевые ногти в домашних условиях — статьи и советы по маникюру

Некоторые моменты требуют быстрой смены лака для ногтей или возможности изменить внешний вид ногтей.

Иногда вы хотите сделать так, чтобы ногти оставались сияющими в течение всей недели. некоторые лаки для ногтей доступны с формулой, обеспечивающей стойкость к износу, которая продлевает стойкость цвета ногтей.Лак для ногтей essie gel couture longwear — это очень простая двухэтапная система для длительного равномерного покрытия, устойчивого к сколам и выцветанию.

Essie gel couture предлагает широкий выбор классических и привлекательных цветов для ногтей, с запатентованной кисточкой с поворотным стержнем легко наносить дома:

шаг 1: после очистки ногтей жидкостью для снятия лака нанесите один слой шикарного лака для ногтей essie gel couture, соответствующего вашему настроению (базовое покрытие не требуется!). добавьте второй слой для более насыщенного цвета.

, шаг 2: нанесите на маникюр специальный гель-верхний слой с финишным покрытием платинового класса. это закрепляет цвет ногтей и обеспечивает мгновенный гелеобразный блеск.

Совет

pro: гель от кутюр сформулирован как система. Для достижения максимального результата важно использовать цвет гель-кутюр и верхнее покрытие одновременно, а также получить желанный маникюр essie couture essie.

, может быть, вы совсем не знакомы с этим лаком для ногтей своими руками. но вы над этим работаете! и, черт его знает, Эсси любит польских художников с амбициями.Хорошие новости: с essie gel couture вам не нужно быть мастером маникюра, чтобы создать искусный и стойкий маникюр. Дизайн кисти, плавное нанесение формулы и быстрый, оптимизированный процесс — все это делает essie gel couture самым простым способом придать салонный вид и гелеобразный блеск прямо в комфорте вашего собственного дома.

, мы провели массу исследований и разработок, чтобы убедиться, что essie gel couture легко освоить. Простота системы, надежная формула без разводов и прецизионная щетка делают процесс легким и удивительно увлекательным.

более того — гель от кутюр essie легко удаляется ацетоновым лаком для ногтей, поэтому ошибки стирания не представляют большого труда.

см. советы по уходу за ногтями от Риты Ремарка здесь. когда вы пытаетесь развить навыки и уверенность в себе, это именно то, что нужно. теперь все, что вам нужно сделать, это попробовать! просто небольшая практика имеет большое значение. То же самое можно сказать об этих стойких и стойких оттенках лака для ногтей.

советов для гелевых ногтей | Гелевые ногти шаг за шагом в домашних условиях

Сделать ногти салонного качества проще, чем вы думаете, когда вы можете сделать это самостоятельно в домашних условиях.Узнайте, как начать пользоваться гелевым лаком для ногтей, прочитав наши 5 основных советов ниже. Более того, мы расскажем, какие инструменты необходимы для создания идеального «мани» — без посещения салона!

1. Всегда готовьте ногти.

Не удалось подготовиться, приготовься к поражению! Подготовка так же важна, как и приложение; особенно если вы хотите стойкие гелевые ногти (кому не нравится ?!)

Прежде чем даже выбрать желаемый цвет лака, убедитесь, что вы выполнили следующие шаги:

  • Продезинфицируйте руки.
  • Используйте пилку для ногтей Bluesky, чтобы придать ногтям желаемую форму. Примечание: не переполняйте файл! Делайте легкие движения в одном направлении.
  • Отодвиньте кутикулу; при необходимости подрежьте их.
  • Аккуратно отполируйте ногти с помощью буфера для ногтей Bluesky, чтобы придать ногтям блеск.
  • Очистите ногти салфеткой Bluesky Cleanser Wipe.

2. Запомните базовое покрытие.

Нанесение базового покрытия перед окрашиванием является частью подготовки.Это основа для стойкого маникюра, поскольку она служит барьером между ногтем и гель-лаком. Мы всегда рекомендуем наносить один тонкий слой базового покрытия Bluesky при каждом нанесении гель-лака.

Базовое покрытие также придает гель-лаку отличную основу, то есть он не отслаивается через несколько дней. Нанесите базовое покрытие и высушите его в течение 30 секунд под светодиодной лампой (1 минуту под УФ), а затем все готово!

3.

Короткими мазками и тонкими слоями.

Наносить каждый слой нужно с осторожностью и вниманием.Вы должны помнить о том, что гель-лак для ногтей отличается от вашего классического лака для ногтей тем, что для него не требуется очень толстый слой.

Убедитесь, что каждый слой, который вы наносите, тонкий, и будьте осторожны с мазками; это позволит вам управлять кистью и поможет вам оставаться в пределах линий! Если вы нанесли слишком много, не волнуйтесь, просто убедитесь, что вы стерли излишки очищающей салфеткой, прежде чем лечить ноготь.

4. Закройте края.

Хотите, чтобы гель-маникюр оставался дольше? Убедитесь, что вы всегда закрываете края! Под этим мы подразумеваем, что при нанесении каждого слоя — включая базовое и верхнее — убедитесь, что вы закрыли свободный край, чтобы закрыть кончик ногтя.Это предотвратит отрыв лака от ногтя и обеспечит лучшую защиту от сколов и царапин.

5. Снимите как следует — без ковыряния!

Может показаться заманчивым выбрать гель для маникюра, чтобы снять его, но наш совет: не делайте этого! Вы можете повредить свои натуральные ногти, сняв гель-лак, а это значит, что вы можете попрощаться со своими красивыми и здоровыми ногтями!

Вместо этого убедитесь, что у вас есть средство для удаления ацетона, и выполните следующие действия:

  • Аккуратно отполируйте ногти, чтобы удалить блеск.
  • Смочите ватный диск в ацетоне и положите его на ноготь.
  • Оберните ноготь и ватный диск небольшим кусочком фольги.
  • Повторите процесс для всех ногтей и подождите около 10 минут — гель должен отслоиться.
  • Осторожно подпилите и отполируйте ноготь по мере необходимости, пока весь гель-лак не будет удален.

Теперь вы знаете наши главные советы по нанесению и уходу за гелевым маникюром, пора начинать! В нашем стартовом наборе есть все инструменты, необходимые для вашего первого гель-маникюра, в том числе светодиодная лампа для ногтей, верхнее и базовое покрытие, очищающие салфетки, пилочка для ногтей, буфер для ногтей и три самых продаваемых цвета гель-лака на выбор.

из.

Обязательно сообщите нам, как у вас дела, отправив нам сообщение на Facebook или Instagram, и отметьте нас в своих проектах — нам нравится видеть, как вы использовали свои цвета Bluesky!

Как правильно наносить гель-лак.

Хотите узнать, как идеально наносить гель-лак?

Это руководство расскажет вам все, что вам нужно знать о нанесении гель-лака для ногтей.

Хотите сразу перейти к тому, как наносить гель-лак для ногтей? Вот пошаговое руководство.

  1. Подготовьте ногти. Вам нужно будет подпилить, отполировать и отодвинуть кутикулы.
  2. Протрите ногти салфеткой для приготовления ногтей или медицинским спиртом, чтобы удалить все остатки.
  3. Нанесите гелевое базовое покрытие и закрепите с помощью УФ- или светодиодной лампы. Ознакомьтесь с инструкциями к вашей лампе, чтобы знать, как долго она должна полимеризоваться.
  4. Нанесите от 3 до 4 тонких слоев цвета, выдерживая между каждым слоем.
  5. Нанесите верхнее гелевое покрытие и снова отвердите.
  6. Сотрите липкий остаток медицинским спиртом.

Теперь, когда вы знакомы с методом, давайте рассмотрим более подробно, как наносить гель-лак для ногтей.

Как подготовить ногти к нанесению гель-лака?

Подготовка ногтей к нанесению гель-лака очень похожа на то, что вы делали бы перед тем, как нанести обычный лак.

Во-первых, вам нужно выбрать длину и форму, в которые вы хотите подпилить ногти.

Техника опиливания зависит от желаемой формы.

Существует множество различных форм на выбор и множество обучающих видео в Интернете, чтобы показать вам, как подпиливать ногти различной формы, например квадратной, круглой, гробовой и миндальной.

При выборе формы следует учитывать несколько моментов.

Некоторые формы подходят для ваших ногтей лучше, чем другие.

Вы хотите выбрать форму, которая подходит вашим ногтям и максимально подчеркивает их естественную форму.

Если ваши ногти от природы имеют, например, довольно квадратную форму, то вам будет легче достичь квадратной или скошенной формы (квадрат с закругленными краями), и она вам больше подойдет.

Вы также должны учитывать состояние ваших ногтей.

Если ваши ногти в действительно хорошем состоянии, вы можете выбрать любую форму, которая вам нравится.

Однако, если у вас тонкие или поврежденные ногти, вы, вероятно, захотите сделать их короткими и круглыми.

Закругленные гвозди с меньшей вероятностью зацепятся за предметы и сломаются, поэтому они обычно служат дольше.

Какое оборудование мне нужно для нанесения гель-лака?

Для нанесения гель-лака вам понадобятся:

  • Пилочка для ногтей.
  • Инструмент для полировки ногтей (необязательно, но дает лучшие результаты).
  • Салфетка для ногтей или медицинский спирт.
  • Некоторые безворсовые салфетки.
  • Гелевое базовое покрытие.
  • Гель-лак выбранного вами цвета.
  • Гелевое верхнее покрытие.
  • УФ или светодиодная лампа.

Мне нравится использовать хрустальную пилочку для ногтей.

Хрустальная пилка немного дороже обычной пилки для ногтей, но я считаю, что она того стоит, потому что вы получаете действительно хорошую отделку.

Пилочки для ногтей

Crystal служат очень долго (моя у меня уже более 3 лет, и мне не нужно было ее менять), поэтому они, вероятно, более экономичны в долгосрочной перспективе.

Вы можете купить буферы для ногтей очень дешево на eBay или Amazon.

Буферы, которые я использую, великолепны, потому что у них четыре стороны, и у каждой свое зерно.

На нем есть инструкции о том, что делать с каждой стороной, написанные на нем, например, удалить гребни, подпилить край ногтя, сгладить ногти и придать им блеск.

Вам не нужно использовать буфер, но если у вас есть гребни на ногтях, он может очень помочь в получении идеального результата.

Вы можете купить специализированные средства для протирания ногтей, но они обычно дороже, чем медицинский спирт, из которого состоит большинство из них.

Важно использовать медицинский спирт или салфетку для подготовки ногтей, прежде чем красить ногти, потому что вам нужно удалить все натуральное масло и остатки пилки для ногтей, чтобы гель-лак не приподнялся и не показывал неровностей.

Салфетки без ворса важны, потому что, если вы используете обычную вату, вы обнаружите, что у вас появятся крошечные волокна, которые будут прилипать к ногтю. Вы не сможете их увидеть, пока не закончите маникюр, и тогда они будут очевидны!

Это случалось со мной так много раз, и это действительно меня раздражает, поэтому просто купите безворсовые салфетки и избавьтесь от стресса. Большинство стартовых наборов для гелевых ногтей, которые вы можете купить, в стандартной комплектации поставляются с безворсовыми салфетками.

Я всегда использую гелевое базовое покрытие и гелевое верхнее покрытие.

Не поддавайтесь соблазну пропустить базовое покрытие, лак может не держаться.

Гелевое верхнее покрытие будет липким после отверждения.

Ногти нужно протирать спиртом. Это дает вам действительно блестящую поверхность, которая придает вашим ногтям профессиональный вид.

Что мне делать: УФ-лампу или светодиодную?

Необходима УФ или светодиодная лампа. На рынке много разных.

Ультрафиолетовые лампы

, как правило, дешевле, но они дольше сохнут.

Ультрафиолетовые лампы

используют ультрафиолетовый свет, похожий на солярий. Типичное время отверждения УФ-лампы составляет около 2 минут.

Ультрафиолетовая лампа теоретически должна отверждать любой тип гель-лака для ногтей.

Светодиодные лампы

более энергоэффективны и экологичны.

Светодиодная лампа может полимеризоваться всего за 15 секунд, и у большинства из них также есть варианты полимеризации в течение 30 или 60 секунд.

На рынке есть некоторые полироли, которые невозможно отвердить с помощью светодиодной лампы, поэтому вам необходимо убедиться, что используемая вами марка совместима со светодиодами.

Я могу сказать вам, что голубой лак для ногтей действительно хорошо работает со светодиодными лампами, но я не уверен в других брендах.

Я бы посоветовал вам купить лампу той же марки, что и полироль, которую вы используете, если это возможно. Многие научные исследования направлены на то, чтобы согласовать формулу полировки с длиной волны света, используемого для отверждения.

Насколько легко нанести гель-лак для ногтей?

Нанести гель-лак для ногтей довольно просто, но к нему нужно привыкнуть.Если вы привыкли пользоваться обычным лаком для ногтей, вы на полпути.

Твердая рука всегда помогает. Вы обнаружите, что гель-лак намного толще обычного лака, поэтому вам, возможно, придется немного изменить свою технику.

Правило номер один.

Нужно нанести несколько тонких слоев гель-лаком, я имею ввиду тонкий! Я часто делаю 4 слоя (или больше, если лак действительно светлого цвета). Это связано с тем, как работает процесс отверждения. Обычно верхний слой лака поглощает весь свет и затвердевает, но если он будет слишком толстым, нижние слои не затвердеют.

Старайтесь не допускать попадания лака на кутикулу.

Если вы испачкали кутикулу, убедитесь, что вы удалили ее, прежде чем лечить. После того, как вы вылечите ногти, они станут твердыми, как камень, и вы не сможете удалить лак с кутикулы!

Не беспокойтесь о полосах. Гель-лак самовыравнивается, поэтому вы не увидите мазков или полос, когда закончите.

Не беспокойтесь о неровностях. Любая небольшая неровность, гребень, кусочки ткани или шерсти домашних животных будут прилипать и появляться под гелевыми ногтями, поэтому перед началом работы убедитесь, что вы их тщательно протерли.

Сколько времени нужно, чтобы нанести гель-лак для ногтей?

Процесс нанесения гель-лака намного быстрее, чем нанесение обычного лака.

Как только вы привыкнете к этому, вы сможете покрыть ногти примерно за час или полтора. Сюда входит время, необходимое для подготовки ногтей и их покраски. Очевидно, что чем быстрее ваша лампа застынет, тем быстрее будет процесс.

Как удалить гель-лак с ногтей?

Снять гель-лак с ногтей намного сложнее, чем его надеть.Вот что вам понадобится.

Жидкость для снятия лака или ацетон.
Немного ваты или безворсовых подушечек.
Оловянная фольга или пластиковые зажимы для ногтей.
Скребок для ногтей или деревянная апельсиновая палочка.
Много терпения!

Для удаления гель-лака можно использовать чистый ацетон. Это работает намного дешевле, чем покупать специальные продукты, рекламируемые как гель для снятия ногтей.

Сначала смочите ватный диск в ацетоне. Нанесите его на ноготь. Вы можете удержать его, обернув ноготь оловянной фольгой, или вы можете очень дешево купить специальные пластиковые зажимы, предназначенные для этой цели.

Дайте ногтям впитаться не менее 15 минут. посмотрите на них. Вы должны увидеть, что лак начинает сниматься сам по себе. Вы можете помочь ему, аккуратно соскребая его апельсиновой палочкой или металлическим скребком для ногтей. Мне нравится использовать апельсиновую палочку, потому что металлические скребки больше повреждают поверхность ногтей.

Если лак не сходит сразу, смочите его снова, используя свежий ватный диск. Подождите еще 15 минут и попробуйте еще раз.

Как удалить гель-лак

Гелевый маникюр может быть одним из величайших изобретений красоты.Позвольте мне объяснить: они устойчивы к сколам и обладают долговечностью, с которой обычный лак для ногтей даже не может конкурировать. Короче говоря, вы можете без проблем иметь идеальные ногти до двух недель.

Теперь один недостаток? Удаление. С тех пор, как разразилась пандемия COVID-19, один из главных вопросов, который я получил как редактор: «Как мне снять этот гель, не повредив ногти?» К сожалению, в отличие от обычного полироля, они не удаляются простым движением ацетона, это требует некоторой работы.

И, к сожалению, если вы не сделаете это должным образом, вы можете повредить ногти, — вздохнул Ли.

Даже если ваш мани продержался четыре недели, пора положить конец. «Вы почувствуете, как он цепляется за все, когда он начнет приподниматься, как и ваши волосы, когда вы моете волосы», — объясняет знаменитый маникюрный мастер из Лос-Анджелеса и консультант ORLY, Бриттни Бойс . «Это на самом деле делает его более подверженным случайному срыву, что более опасно для ваших ногтей».

Впереди — подробное описание того, как точно удалить гель-маникюр от экспертов.

Шаг первый: файл

Салонный напильник для тяжелых и средних условий эксплуатации с отделкой салона, черный

Никогда и никогда не подпиливайте ноготь полностью, — предупреждает Бойс. Гелевый маникюр обычно состоит из четырех слоев лака, поэтому вам нужно отполировать верхний слой, но на этом вы остановитесь.

«Всегда подавайте с равномерным давлением», — добавляет Бойс. «Спилите примерно 30-50% геля, а затем позвольте ацетону сделать остальную работу.Если начинает болеть или вы чувствуете жжение, значит, вы напилили слишком много ».

Надин Абрамчик, соучредитель tenoverten , соглашается. «Действуйте осторожно и помните, что вы всегда можете вернуться, чтобы отпилить еще больше, но вы не сможете обратить вспять повреждения от опиливания поверх натурального ногтя, когда это было сделано», — добавляет она.

Шаг второй: замачивание

Средство для снятия лака с ацетоном

Для такой работы нужен ацетон. Какое бы средство для снятия лака в аптеке вы ни завалили, этого вам не подойдет.Если вы хотите, чтобы гелевый маникюр исчез, используйте ацетон.

«Это должен быть 100% чистый ацетон, а не жидкость для снятия лака или смесь для снятия лака», — подчеркивает мастер по маникюру Эри Ишизу . «Средство для снятия лака не впитывает гели». Она также рекомендует нанести немного масла на кутикулы, прежде чем обматывать их ацетоном, чтобы избежать чрезмерной сухости.

По словам Абрамчика, лучший способ замачивания в домашних условиях — это «намочить кусок ваты в ацетоне и положить по одному на каждый ноготь, а затем обернуть каждый ноготь фольгой, чтобы ватные шарики оставались на месте и прижались к ногтю».”

Но если у вас нет этого под рукой, чаша подойдет. Сара Гибсон Таттл , основательница маникюрного салона в Лос-Анджелесе Olive & June, добавила отличный совет от профессионала: «Нам также нравится оборачивать горячее полотенце, чтобы ускорить процесс замачивания».

Шаг третий: подождите

Ишизу советует клиентам подождать около десяти минут, прежде чем начнется процесс подъема. «Иногда это занимает больше времени, поэтому не торопитесь, не царапайте слишком сильно и не подпиливайте их, все это повреждает ногти», — добавляет Ишизу.

Обернув пальцы фольгой, вы ничего не сможете сделать, но у Гибсона Таттла есть исправление. «Удалите, пока вы общаетесь по FaceTim с другом или смотрите телевизор, чтобы у вас не возникло соблазна повредить ногти в спешке», — предлагает Гибсон Таттл.

После того, как ногти пропитаны ацетоном, лак обычно отслаивается самостоятельно, без особых усилий. Если вы наткнулись на твердое пятно, замажьте его заново и замочите еще на пять минут.

Еще один совет от профессионала? Подержите руки под проточной водой и используйте палочку из апельсинового дерева (которая является толкателем кутикулы), чтобы аккуратно снять гель с ногтя, объясняет Абрамчик.

Этот контент импортирован из Instagram. Вы можете найти тот же контент в другом формате или найти дополнительную информацию на их веб-сайте.

Шаг четвертый: отделка и лечение

Затем обязательно используйте масло для укрепления ногтей, чтобы восстановить ногти. «Наносите масла несколько раз в день, чтобы вернуть ногти к жизни», — добавляет Абрамчик ». Если у вас нет специального масла для ногтей, используйте кокосовое или даже оливковое масло. Это поможет увлажнить ногтевое ложе и сохранить ногти здоровыми на долгое время.

Существует распространенное заблуждение, что удаление геля делает ногти ломкими и нездоровыми. Гибсон Таттл уверяет, что это не так: «Удаление не повредит ногти, если оно выполняется правильно и терпеливо», — говорит она. «Но снятие гелей повредит ногти и может предотвратить прилипание лака или геля в будущем».

В любом случае лучше меньше, да лучше. «В любом случае рекомендуется делать перерыв каждые три-четыре месяца», — добавляет Бойс. «Сейчас идеальное время, так как мы дома.Кроме того, врачи рекомендуют короткие ногти, чтобы ничто не попало под ногти ».

Как только вы вернетесь к обычному полировке, выберите укрепляющее базовое покрытие, чтобы сформировать защитный слой на ногте. «Наслаждайтесь перерывом от гелей, вы можете быть удивлены тем, насколько весело вы экспериментируете с натуральным лаком для ногтей для маникюра своими руками, когда застряли дома», — предлагает Абрамчик.

Купите набор для удаления геля

Средство для снятия лака Deborah Lippmann The Stripper

Обертки для удаления фольги GELFX

Орли
orlybeauty.ком

20,00 долл. США

Набор многофункциональных пилок из 6 предметов

Кейби Цитом
amazon.com

6,99 долл. США

tenoverten Масло для ногтей из сельдерея

Tenoverten
target.com

26,00 долл. США

Пинцет, двусторонний напористый

амазонка.ком

Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты. Вы можете найти больше информации об этом и подобном контенте на сайте piano.io.

VOXURY Nail Art Гель-лак Живопись Гель Гибридные ногти УФ-дизайн Для маникюра Праймер Гель-лак для ногтей — купить по низким ценам в интернет-магазине Joom

Особенности товара
Бренд: voxury
Тип товара: гель для ногтей
Состав: Смола
Количество: 1 шт.
Тип: Гель для рисования
Вес нетто: 5 мл
Номер модели: VF
Цвет: 36 цветов
корабли из: Китай
Используется для: нейл-арта
Требуется: УФ-лампа
Применение: маникюрный салон / ногтей Beaty / DIY ногтей и подарок и т. Д.
Инструменты: УФ-лампа Светодиодная лампа
Преимущество: простота обращения
описание продукта
Бренд: Voxury
Материалы: УФ-отверждаемая смола
Объем: 5 мл
Инструменты для отверждения: УФ-лампа, светодиодная лампа, УФ / светодиодная лампа CCFL

Теплые наконечники:
1.Избегайте любого контакта с кожей. При появлении покраснения или других признаков побочной реакции немедленно прекратите использование.
2. Хранить плотно закрытым. Беречь от солнечного света. Храните в недоступном для детей месте.
3. обратите внимание, что из-за различного освещения и компьютерных дисплеев фактические цвета могут незначительно отличаться от изображений.

Характеристика:
-Качество — наш первый приоритет.
-Свет, почти без запаха, мы наносим только органическую текстуру для защиты вашего здоровья.
-Подходит на все случаи жизни.
-Профессиональный подарок для себя или своей девушки

Шаг за шагом
Шаг 1.Очистите ногти, затем обрежьте поверхность ногтя, как при обычном маникюре.
Шаг 2. Полностью взболтайте одноэтапный гель, он может сбалансировать цвет лака. (Важный)
Шаг 3. Сначала нанесите базовое покрытие, которое может продлить стойкость лака, отвердите УФ-лампой или светодиодной лампой. (Необходимый)
Шаг 4. Нанесите лак непосредственно, закрепите УФ-лампой в течение 2-3 минут или закрепите светодиодной лампой в течение 60 секунд; Когда высохнет, нанесите 2-й слой и снова закрепите лампой UB или светодиодной лампой.
Шаг 5. Нанесите съемный верхний слой, который сделает цвет более сияющим, затем закрепите УФ-лампой или светодиодной лампой.Шаг 6. Очистите поверхность ногтя моющим средством для ногтей. Примечание: избегайте использования неспециализированных чистящих жидкостей, так как они могут повлиять на качество окончательного глянцевого покрытия.

Чтобы удалить:
Шаг 1.

Как создать собственный праймер? | Часто задаваемые вопросы по секвенированию / фрагментному анализу по Сэнгеру

Одним из наиболее важных факторов успешного автоматического секвенирования ДНК является правильный дизайн праймера. В этом документе описаны этапы этого процесса и основные подводные камни, которых следует избегать.

**** Используйте компьютер для разработки праймеров ****

Мы настоятельно рекомендуем использовать компьютер при проектировании грунтовки для проверки некоторых критических дефектов конструкции. | | BamHI EcoRI

Если вы клонировали интересующую вас ДНК между сайтами BamHI и EcoRI, вы можете секвенировать с помощью праймера «CTTGATGCTAGTACTACATC» (помните — он написан от 5 ‘до 3’), и вы получите следующую последовательность из ядра:

 TAGTGCTAGATG [your-insert-'top '-strand-Bam-to-Eco] AATTCGCTGATGC...(так далее.)
 

Что, если вам нужна последовательность из другой цепочки — от Eco до Bam — вместо этого? В этом случае вам нужно выбрать некоторую последовательность на справа , а затем обратным дополнением ее перед запросом олигонуклеотида. Выбираем последовательность из рисунка выше:

 CTGATGCTCATATGTTAATA
 

Это НЕ последовательность праймера — она ​​дословно скопирована из указанной выше последовательности. Фактически, если вы использовали эту последовательность в качестве праймера, секвенирование продолжалось бы на вправо, от вставки .Вместо этого дополните эту последовательность в обратном порядке:

 TATTAACATATGAGCATCAG
 

ТЕПЕРЬ это должно произвести последовательность противоположной цепи:

 CGAATT [your-insert-'bottom '-strand-Eco-to-Bam] CATCTAGCACTA ... (и т. Д.)
 

Мелкий шрифт: лишь в редких случаях при секвенировании действительно обнаруживаются нуклеотиды, расположенные непосредственно после праймера. Я получил некоторую дидактическую лицензию в приведенных выше примерах.


Более сложные концепции: как создать эффективный учебник для начинающих.

Обычно вы начинаете с небольшого количества известной последовательности, которую хотите расширить. Вот как действовать:

I. Создавайте праймеры только на основе точных данных о последовательности.
Автоматическое секвенирование (и фактически любое секвенирование) имеет конечную вероятность возникновения ошибок. Последовательность, полученная слишком далеко от праймера, следует рассматривать как сомнительную. Чтобы определить, что «слишком далеко», мы настоятельно рекомендуем нашим клиентам прочитать памятку «Интерпретация хроматограмм секвенирования», в которой описывается, как оценивать достоверность данных, полученных с помощью секвенсоров ABI.Выберите область для размещения праймера, где вероятность ошибки последовательности низкая.
II. Ограничьте поиск регионами, которые лучше всего соответствуют вашим целям.

Вы можете быть заинтересованы в максимальном увеличении полученных данных последовательности, или вам может потребоваться исследовать последовательность только в очень конкретном месте в шаблоне. Такие потребности диктуют совершенно разные варианты размещения грунтовки.

  1. Максимизируйте полученную последовательность, сведя к минимуму вероятность ошибок:
    Как правило, вы должны проектировать праймер настолько далеко, насколько это возможно, до 3 ‘, если вы уверены в точности последовательности, из которой взят праймер.Праймеры на противоположных прядях следует наносить по возможности в шахматном порядке.
  2. Целевое секвенирование определенной области:
    Разместите праймер так, чтобы желаемая последовательность попадала в наиболее точную область хроматограммы. Данные последовательности часто наиболее точны на расстоянии 80–150 нуклеотидов от праймера. Не рассчитывайте увидеть хорошую последовательность на расстоянии менее 50 нуклеотидов от праймера или более 300 нуклеотидов (хотя мы часто получаем последовательность, начинающуюся сразу после праймера, и мы часто возвращаем 700 нуклеотидов точной последовательности).
III. Найдите кандидатные праймеры:

Определите потенциальные праймеры для секвенирования, которые обеспечивают стабильное спаривание оснований с матричной ДНК в условиях, подходящих для циклического секвенирования. настоятельно рекомендует использовать компьютер на этом этапе. Предлагаемые характеристики грунтовки:

  1. Длина должна быть от 18 до 30 нит, оптимальная — 20-25 нит. (Хотя у нас были некоторые успехи с праймерами длиннее 30 и короче 18).
  2. G-C желательно содержание 40-60%.
  3. Tm должна быть между 55 C и 75 C. Предупреждение: старое правило «4 градуса для каждого G-C, 2 градуса для каждого A-T» работает плохо, особенно для олигонуклеотидов короче 20 или длиннее 25 узлов. Вместо этого попробуйте:
     Tm = 81,5 + 16,6 * log [Na] + 0,41 * (% GC) - 675 / длина - 0,65 * (% формамида) - (% несоответствия) 
IV. Откажитесь от праймеров-кандидатов, которые демонстрируют нежелательную самогибридизацию.
Праймеры

, способные к самогибридизации, будут недоступны для гибридизации с шаблоном.Как правило, избегайте праймеров, которые могут образовывать 4 или более последовательных связей между собой или всего 8 или более связей. Пример незначительно проблемной грунтовки:

 5'-ACGATTCATCGGACAAAGC-3 '
                                                   |||| ||||
                                        3'-CGAAACAGGCTACTTAGCA-5 '

Этот олиго образует по существу стабильный димер сам с собой с четырьмя последовательными связями в двух местах и ​​всего восемью межцепочечными связями.

Праймеры с 3′-концами, гибридизирующиеся даже временно, будут удлиняться из-за действия полимеразы, таким образом разрушая праймер и создавая ложные полосы. Будьте несколько строже, избегая 3′-димеров. Например, следующий праймер самодимеризуется с идеальной 3′-гибридизацией на самом себе:

 5'-CGATAGTGGGATCTAGATCCC-3 '
                                                       ||||||||||||||
                                                    3'-CCCTAGATCTAGGGTGATACG-5 '

Вышеупомянутый олиго очень плохой и почти гарантированно вызовет проблемы.Обратите внимание, что полимераза удлиняет 3′-конец во время реакции секвенирования, давая очень сильную последовательность ACTATGC. Эти полосы появятся в начале ваших «реальных» данных в виде огромных пиков, перекрывая правильную последовательность. Большинство программ разработки праймеров правильно определят такие самодимеризующиеся праймеры и предупредят вас, чтобы вы их избегали.

Обратите внимание, однако, что никакая компьютерная программа или эмпирическая оценка не может точно предсказать успех или неудачу учебника. Праймер, который кажется маргинальным, может работать хорошо, в то время как другой, который кажется безупречным, может вообще не работать.Избегайте очевидных проблем, создавайте лучшие праймеры, которые вы можете, но в крайнем случае, если у вас мало вариантов, просто попробуйте несколько праймеров-кандидатов, независимо от потенциальных недостатков.

V. Проверьте сайт-специфичность праймера.
Выполните поиск гомологии последовательности (например, сравнение гомологии точечной диаграммы) по всей известной матричной последовательности, чтобы проверить наличие альтернативных сайтов прайминга. Откажитесь от любых праймеров, которые проявляют «значительную» тенденцию связываться с такими сайтами. Мы можем дать лишь приблизительные рекомендации относительно того, что является «значимым».Избегайте праймеров, в которых присутствуют альтернативные сайты с (1) более чем 90% гомологией с первичным сайтом или (2) более чем 7 последовательными гомологичными нуклеотидами на 3′-конце, или (3) численностью более чем в 5 раз выше, чем предполагаемое праймирование. сайт.
VI. Выбор среди праймеров-кандидатов.

Если на этом этапе у вас есть несколько праймеров-кандидатов, вы можете выбрать один или несколько, которые более богаты А-Т на 3′-конце. По мнению некоторых исследователей, они имеют тенденцию быть немного более конкретными в действии.Вы можете использовать более одного праймера, чтобы увеличить вероятность успеха.

Если у вас нет кандидатов, которые выдержали вышеуказанные критерии, вы можете быть вынуждены ослабить строгость требований к отбору. В конце концов, проверка хорошего праймера заключается только в его использовании, и эти упрощенные практические правила не могут быть точно предсказаны.

Однако, если повезет, у вас есть множество вариантов грунтовок. Для проекта сборки последовательностей разработайте больше праймеров, чем вы думаете, что вам действительно нужно, чтобы, если последовательность не такая длинная, как вы надеялись, вы все равно могли получить достаточно перекрывающихся данных, чтобы гарантировать хороший консенсус последовательности.Мы рекомендуем вам секвенировать и нити для лучшего подтверждения. На одной нити разместите праймеры от 500 до 700 нт (более короткие интервалы безопаснее!). На противоположной цепи разместите праймеры в шахматном порядке от праймеров первой цепи, как показано ниже:

Справка по вводу Primer3

Справка по вводу Primer3 Некоторые из наиболее важных вопросов при выборе грунтовки могут быть рассматривается только перед использованием Primer3. Это качество последовательности (включая проверку того, что последовательность не является векторной и не химерический) и избегая повторяющихся элементов.

Методы избежания проблем включают в себя полное понимание возможных векторных загрязнителей и артефактов клонирования, связанных с поиском в базе данных с использованием blast, fasta или другого подобия программа поиска для выявления векторных загрязнений и возможных повторяется. Repbase (J. Jurka, A.F.A. Smit, C.Pethiyagoda и другие, 1995-1996 гг., ftp://ncbi.nlm.nih.gov/repository/repbase) отличный источник повторяющихся последовательностей и указателей на литература. Primer3 теперь позволяет проверять олигонуклеотидов-кандидатов. против библиотеки ошибочного запуска (или библиотеки Mishyb в случае внутренних олиго).

Качество последовательности можно контролировать с помощью ручного просмотра трассы и качественные программы клиппирования или автоматические качественные клипсирующие программы. Низкий- качественные базы должны быть изменены на N или могут быть включены в Исключенные регионы. Начало секвенирования чтения часто проблематично из-за пиков праймера, и конец чтения часто содержит много некачественных или даже бессмысленных именных баз. Поэтому при отборе праймеров из однопроходной последовательности часто лучше использовать параметр Включенная область, чтобы гарантировать, что Primer3 выбирает праймеры в области считывания высокого качества.Кроме того, Primer3 принимает в качестве входных данных Качество последовательности список для использовать с этими программами вызова базы такие как Фред (http://www.mbt.washington.edu/phrap_documentation.html) которые выводят эту информацию.

Исходная последовательность
Последовательность выбора праймеров или гибридизации олиго.
Идентификатор последовательности
Идентификатор, который воспроизводится в выходных данных, чтобы вы могли определить выбранные праймеры.
Цели
Если указана одна или несколько целей, то должна быть допустима пара праймеров. флангируйте хотя бы один из них.Цель может быть простой последовательностью сайт повторения (например, повтор CA) или одна пара оснований полиморфизм. Значение должно быть разделенным пробелами списком
  начало , длина  
 
пары, где начало — это индекс первой базы Target, а длина — его длина.
Исключенные регионы
Праймерные олигонуклеотиды могут не перекрывать какую-либо область, указанную в этом теге. Связанное значение должно быть разделенным пробелами списком
  начало , длина  
 
пары, где начало — это индекс первой базы исключенная область, а длина , длина — ее длина.Этот тег полезно для таких задач, как исключение областей с низкой последовательностью качество или для исключения регионов, содержащих повторяющиеся элементы такие как ALU или LINE.
Размер продукта
Минимальная, оптимальная и максимальная длина (в основаниях) продукта ПЦР. Primer3 не создает грунтовки с продуктами короче Min. или длиннее, чем Max, и с аргументами по умолчанию Primer3 будет попытаться подобрать грунтовки, производящие продукцию близкую к Оптимальной длина,
Номер для возврата
Максимальное количество возвращаемых пар праймеров.Пары праймеров возвращенные сортируются по их «качеству», другими словами, по значение целевой функции (где меньшее число указывает лучше пара праймеров). Внимание: установите для этого параметра большое значение. значение увеличит время работы.
Максимальная устойчивость на 3 фута
Максимальная устойчивость для пяти трехфутовых оснований левого или правого грунтовка. Чем больше число, тем стабильнее 3 ‘концов. Ценность максимальная дельта G для дуплексного разрыва для пяти 3 ‘баз как рассчитано с использованием параметров ближайшего соседа, опубликованных в Breslauer, Frank, Bloeker and Marky, Proc.Natl. Акад. Sci. США, vol 83, pp 3746-3750. Рычлик рекомендует максимальное значение 9. (Войцех Рихлик, «Выбор праймеров для полимеразной цепи» Реакция »в ред. Б.А. Уайта« Методы молекулярной биологии ». Vol. 15: Протоколы ПЦР: современные методы и приложения », 1993 г., pp 31-40, Humana Press, Totowa NJ).
Макс. Ошибочная заправка
Максимально допустимое взвешенное сходство с любой последовательностью в Библиотека ошибочного запуска. По умолчанию 12.
Макс. Ошибочная заправка пары
Максимально допустимая сумма взвешенных сходств пары праймеров (одно сходство для каждого праймера) с любой последовательностью в Библиотека ошибочного запуска.По умолчанию 24.
Размер грунтовки
Минимальная, оптимальная и максимальная длина (в основаниях) олигонуклеотида праймера. Primer3 не подбирает грунтовки короче Min или длиннее чем Max, и с аргументами по умолчанию попытается выбрать праймеры близко с размером, близким к опт. Мин не может быть меньше 1. Макс не может быть больше 36. (Этот предел регулируется максимальным размером олиго, для которого верны расчеты температуры плавления.) Мин не может быть больше Макс.
Праймер Тм
Минимальная, оптимальная и максимальная температуры плавления (по Цельсию) для праймера олиго.Primer3 не подберет олигонуклеотидов с температурой меньше Min или больше Max и с условиями по умолчанию постараюсь подобрать грунтовки с температурой плавления близкой к опт.

Primer3 использует формулу температуры плавления олигонуклеотидов, приведенную в Рычлик, Спенсер и Роадс, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 и Breslauer, Frank, Bloeker and Marky, Proc. Natl. Акад. Sci. USA, vol 83, pp 3746-3750. Пожалуйста, обратитесь к предыдущему документу для предварительного обсуждения.

Максимальная разница Tm
Максимально допустимая (беззнаковая) разница плавления температуры левого и правого грунтовки.
Продукт TM
Минимальная, оптимальная и максимальная температура плавления ампликон. Primer3 не подберет продукт с плавлением температура ниже мин. или выше макс. Если предоставляется опция Opt и штрафные веса для продукта Размер не равен 0 Primer3 попытается выбрать ампликон с температура плавления близка к опт.

Primer3 рассчитывает температуру плавления продукта по формуле (iii) от Rychlik, Spencer and Rhoads, Nucleic Acids Research 18:21 с.6410.

Грунтовка GC% Минимальное, оптимальное и максимальное процентное содержание G и C в любой грунтовке.
Макс.комплементарность
Максимально допустимый балл локального выравнивания при тестировании одного праймер для (локальной) самодополнимости и максимально допустимого оценка локального согласования при тестировании на взаимодополняемость между левый и правый праймеры. Локальная самодополняемость принимается прогнозировать тенденцию праймеров к отжигу друг с другом без обязательно вызывает самовсасывание в ПЦР.Система подсчета очков дает 1.00 за дополнительные базы, -0.25 за совпадение с любой базой (или N) с N, -1,00 для несоответствия и -2,00 для разрыва. Разрешены только пробелы в одну пару оснований. Например, выравнивание
5 'ATCGNA 3'
   || | |
3 'TA-CGT 5'
 
разрешено (и дает 1,75 балла), но выравнивание
5 'ATCCGNA 3'
   || | |
3 'TA - CGT 5'
 
не считается. Оценки неотрицательные, 0,00 указывает на отсутствие разумного локального выравнивания между двумя олиго.
Макс. 3 ‘комплементарность
Максимально допустимая оценка глобального выравнивания с 3′-якорем, когда тестирование единственного праймера на самокомплементарность и максимальную допустимая оценка глобального выравнивания с 3′-якорем при тестировании на комплементарность между левым и правым праймерами. 3′-якорная оценка глобального согласования используется для прогнозирования вероятности Праймеры-димеры для ПЦР, например
5 'ATGCCCTAGCTTCCGGATG 3'
             ||| |||||
          3 'AAGTCCTACATTTAGCCTAGT 5'
 
или же
5` AGGCTATGGGCCTCGCGA 3 '
               ||||||
            3 'AGCGCTCCGGGTATCGGA 5'
 
Система баллов такая же, как и для максимальной комплементарности. аргумент.В приведенных выше примерах оценки 7,00 и 6,00. соответственно. Оценки неотрицательные, 0,00 указывает, что не существует разумного 3′-привязанного глобального выравнивание между двумя олигонуклеотидами. Для оценки 3′-якорной глобальное выравнивание кандидатных праймеров и пар праймеров, Primer предполагает, что последовательность, из которой следует выбирать праймеры, представлены 5 ‘-> 3’. Бессмысленно указывать большее значение для этого параметра, чем для максимальной (локальной) дополнительности параметр, потому что оценка локального выравнивания всегда будет на по крайней мере так же хорошо, как оценка глобального выравнивания.
Макс Poly-X
Максимально допустимая длина мононуклеотидного повтора, например AAAAAA.
Включенная область
Подобласть данной последовательности, в которой нужно выбрать праймеры. Для например, часто первая дюжина или около того оснований последовательности вектор, и его следует исключить из рассмотрения. Значение для этот параметр имеет вид
  начало , длина  
 
где начало — это индекс первой рассматриваемой базы, а длина — количество последующих оснований в грунтовка регион.
Позиция стартового кодона
Этот параметр следует считать ЭКСПЕРИМЕНТАЛЬНЫМ на данном этапе. Пожалуйста, внимательно проверьте вывод; некоторые ошибочные вводы могут вызвать ошибку в Primer3. Индекс первой базы стартового кодона. Этот параметр позволяет Primer3 для выбора пар праймеров для создания ампликонов в рамке считывания например создать шаблон для гибридного белка. Primer3 будет попытаться выбрать левый праймер в рамке, в идеале начиная с или слева от стартового кодона или справа, если необходимо.6 указывает, что Primer3 должен игнорировать это параметр. Primer3 выбирает положение правильного праймера путем сканирования справа от левого праймера для стоп-кодона. В идеале правильный праймер оканчивается на стоп-кодоне или после него.
Библиотека ошибочного запуска
Этот выбор указывает, какая библиотека ошибочной заливки (если есть) Primer3 следует использовать для скрининга перемежающихся повторов или для другой последовательности, которую следует избегать в качестве места для праймеров.
Зажим CG
Требуется указанное количество последовательных G и C на 3 ‘ конец как левого, так и правого праймера.(Этот параметр не имеет влияние на гибридизационный олигонуклеотид, если таковой требуется.)
Концентрация соли
Миллимолярная концентрация соли (обычно KCl) в ПЦР. Primer3 использует этот аргумент для расчета плавления олигонуклеотидов. температуры.
Концентрация олигонуклеотидов при отжиге
Наномолярная концентрация олигонуклеотидов отжига в ПЦР. Primer3 использует этот аргумент для расчета плавления олигонуклеотидов. температуры. Значение по умолчанию (50 нм) хорошо работает со стандартным протокол, используемый в Центре генома Уайтхеда / Массачусетского технологического института Исследования — 0.5 микролитров 20 микромолярной концентрации для каждого праймер олиго в реакции 20 микролитров с 10 нанограммами шаблон, 0,025 единиц / микролитр полимеразы Taq в 0,1 мМ каждый dNTP, 1,5 мМ MgCl2, 50 мМ KCl, 10 мМ Tris-HCL (pH 9,3) с использованием 35 циклы с температурой отжига 56 градусов Цельсия. Этот параметр соответствует ‘c’ в Rychlik, Spencer and Rhoads ‘ уравнение (ii) (Nucleic Acids Research, vol 18, num 12), где a подходящее значение (для более низкой начальной концентрации шаблона) составляет «эмпирически определено».Значение этого параметра меньше чем фактическая концентрация олигонуклеотидов в реакции, потому что это концентрация олигонуклеотидов отжига, которые, в свою очередь, зависит от количества шаблона (включая продукт ПЦР) в данный цикл. Эта концентрация сильно увеличивается во время ПЦР; к счастью, ПЦР кажется достаточно надежной для различных олигонуклеотидов. температуры плавления.
Максимальное количество принимаемых нс
Максимально допустимое количество неизвестных оснований (N) в любой грунтовке.
Либеральная база
Этот параметр обеспечивает быстрый и грязный способ заставить Primer3 принимать коды IUB / IUPAC для неоднозначных оснований (т.е.е. путем изменения все непризнанные базы до N). Если вы хотите включить двусмысленный база в олиго, вы должны установить Максимальное количество принятых на значение, отличное от 0. Возможно, ‘-‘ и ‘*’ следует выжать, а не изменить в ‘N’, но в настоящее время они просто преобразуются в N. Авторы приглашать комментарии пользователей.
Первый базовый индекс
Индекс первой базы во входных последовательность. Для ввода и вывода с использованием индексации на основе 1 (например, который используется в GenBank и к которому привыкли многие пользователи) этот параметр на 1.Для ввода и вывода с использованием индексации на основе 0 установите для этого параметра значение 0. (Этот параметр также влияет на индексы в содержимом файлов, созданных, когда праймер установлен флаг файла.) В интерфейсе WWW этот параметр по умолчанию равен 1.
Штраф за внутреннюю границу
Значения, отличные от значений по умолчанию, действительны только для последовательностей с 0 или 1 целевыми регионами. Если праймер входит в пару, охватывает цель и перекрывает цель, затем умножьте это значение умноженное на количество нуклеотидных позиций, по которым праймер перекрывает (уникальную) цель, чтобы получить «штраф позиции».В эффект этого параметра заключается в том, чтобы позволить Primer3 включать перекрытие с целью в качестве члена целевой функции.
Штраф за пределами цели
Значения, отличные от значений по умолчанию, действительны только для последовательностей с 0 или 1 целевыми регионами. Если праймер входит в пару, охватывает цель и не перекрывает цель, затем умножается это значение умножается на количество нуклеотидных позиций от 3 ‘ конец (уникальной) цели, чтобы получить «штраф позиции». Эффект этого параметра заключается в том, чтобы позволить Primer3 включать близость к цели как член целевой функции.
Показать информацию об отладке
Включите ввод в primer3_core как часть вывода.
Качество последовательности
Список целых чисел, разделенных пробелами. Должен быть ровно один целое число для каждой базы в исходной последовательности, если этот аргумент не пуст. Высокие числа указывают на высокую уверенность в базовом вызове при этом позиция и низкие числа указывают на низкое доверие к базе позвоните в эту позицию.
Мин. Качество последовательности
Минимальное качество последовательности (как указано в Sequence Quality) допускается в праймере.
Мин. 3 ‘Качество последовательности
Минимальное качество последовательности (как указано в Sequence Quality) допускается в пределах 3 ‘пентамера праймера.
Минимальный диапазон качества последовательности
Минимальное качество юридической последовательности (используется для интерпретации Минимальное качество последовательности и Минимальное качество последовательности 3 ‘).
Максимальный диапазон качества последовательности
Максимальное качество юридической последовательности (используется для интерпретации Минимальное качество последовательности и Минимальное качество последовательности 3 ‘).
В этом разделе описаны «штрафные веса», которые позволяют пользователь может изменить критерии, которые использует Primer3. выбрать «лучшие» грунтовки. Есть два класса весов: для некоторых параметров есть ‘Lt’ (меньше чем) и вес ‘Gt’ (больше чем). Эти веса, которые Primer3 использует, когда значение меньше или больше указанного оптимума (соответственно). Следующие параметры имеют веса Lt и Gt:
  • Размер продукта
  • Размер грунтовки
  • Праймер Тм
  • Продукт Tm
  • Праймер GC%
  • Hyb Oligo Размер
  • Hyb Oligo TM
  • Hyb Oligo GC%
Штраф внутренней мишени и штраф за пределами мишени похожи, за исключением того, что они связаны позиции они не поддаются Номенклатура «Lt» и «Gt».

По остальным параметрам понимается оптимум и фактическое значение может изменяться только в одном направлении от оптимума:

  • Самодополнимость праймера
  • Primer 3 ‘Самодополняемость
  • Грунтовка № N’s
  • Сходство с ошибочной заливкой праймеров
  • Качество последовательности праймеров
  • Primer 3 ‘Качество последовательности
  • Праймер 3 ‘Стабильность
  • Самодоплементарность Hyb Oligo
  • Hyb Oligo 3 ‘Самодоплементарность
  • Сходство с ошибочным зачатком Hyb Oligo
  • Качество последовательности Hyb Oligo
  • Hyb Oligo 3 ‘Качество последовательности
Специально обрабатываются следующие веса:
Позиция Штрафной вес
Определяет общий вес штрафа за позицию при расчете штрафа за грунтовку.
Грунтовка Масса
Определяет вес 2 штрафа грунтовки в вычисление штрафа пары праймеров.
Hyb Oligo Вес
Определяет вес штрафа hyb oligo в расчет штрафа пары праймеров плюс гиб олиго.
Следующее определяет вес, придаваемый различным параметры пар праймеров (или пар праймеров плюс hyb oligo).
  • Тм разница
  • Комплементарность грунтовки к грунтовке
  • Primer-Primer 3 ‘Комплементарность
  • Сходство пары праймеров с ошибочной заправкой
Параметры, определяющие выбор внутреннего олигонуклеотиды аналогичны параметрам, определяющим выбор пар праймеров.Исключением является максимальная комплементарность 3 ‘. что бессмысленно при применении к внутренним олигонуклеотидам, используемым для обнаружения на основе гибридизации, поскольку праймер-димер не образуется. Мы рекомендуем Max 3 ‘комплементарность должно быть установлено как минимум равным максимальной комплементарности. Авторское право (c) 1996,1997,1998 Институт биомедицинских исследований Уайтхеда. Все права защищены.

Распространение и использование в исходной и двоичной формах, с или без модификации, разрешены при соблюдении следующих условий:

  1. При повторном распространении должно воспроизводиться указанное выше уведомление об авторских правах, это список условий и следующий отказ от ответственности в документации и / или другие материалы, поставляемые с распространением.Распространение исходный код также должен воспроизводить эту информацию в самом исходном коде.
  2. Если программа изменена, повторное распространение должно включать уведомление (в тех же местах, что и выше), что указывает на то, что распространяемая программа не идентична версии, распространяемой Институтом Уайтхеда.
  3. Все рекламные материалы, в которых упоминаются особенности или использование этого программное обеспечение должно отображать следующее подтверждение:
    Этот продукт включает программное обеспечение, разработанное Институт биомедицинских исследований Уайтхеда.
  4. Название Института Уайтхеда не может использоваться для подтверждения или продвигать продукты, созданные на основе этого программного обеспечения, без предварительного письменного разрешение.
Мы также просим, ​​чтобы использование этого программного обеспечения упоминалось в публикациях как
Стив Розен, Хелен Дж. Скалецки (1998) Primer3. Код доступен на http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
ДАННОЕ ПРОГРАММНОЕ ОБЕСПЕЧЕНИЕ ПРЕДОСТАВЛЯЕТСЯ ИНСТИТУТОМ WHITEHEAD « КАК ЕСТЬ » И ЛЮБЫМ ЯВНЫЕ ИЛИ ПОДРАЗУМЕВАЕМЫЕ ГАРАНТИИ, ВКЛЮЧАЯ, НЕ ОГРАНИЧИВАясь, ПОДРАЗУМЕВАЕМЫЕ ГАРАНТИИ КОММЕРЧЕСКОЙ ЦЕННОСТИ И ПРИГОДНОСТИ ДЛЯ КОНКРЕТНОЙ ЦЕЛИ ЯВЛЯЮТСЯ ОТКАЗ ОТ ОТВЕТСТВЕННОСТИ.НИ ПРИ КАКИХ ОБСТОЯТЕЛЬСТВАХ ИНСТИТУТ WHITEHEAD НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ЗА ЛЮБЫЕ ПРЯМЫЙ, КОСВЕННЫЙ, СЛУЧАЙНЫЙ, ОСОБЫЙ, ПРИМЕРНЫЙ ИЛИ КОСВЕННЫЙ УБЫТК (ВКЛЮЧАЯ, НО НЕ ОГРАНИЧИВАЯСЬ, ЗАКУПКИ ТОВАРОВ ЗАМЕНЫ ИЛИ СЕРВИСЫ; ПОТЕРЯ ИСПОЛЬЗОВАНИЯ, ДАННЫХ ИЛИ ПРИБЫЛИ; ИЛИ ПЕРЕРЫВ В ДЕЯТЕЛЬНОСТИ) ОДНАКО ПРИЧИНЕННАЯ И ПО ЛЮБОЙ ТЕОРИИ ОТВЕТСТВЕННОСТИ, ЛИБО ПО КОНТРАКТУ, СТРОГО ОТВЕТСТВЕННОСТЬ ИЛИ НЕИСПРАВНОСТЬ (ВКЛЮЧАЯ НЕБРЕЖНОСТЬ ИЛИ ИНОЕ), ВОЗНИКАЮЩИЕ ЛЮБЫМ СПОСОБОМ НЕ ИСПОЛЬЗОВАНИЕ ДАННОГО ПРОГРАММНОГО ОБЕСПЕЧЕНИЯ, ДАЖЕ ЕСЛИ УКАЗАНО ВОЗМОЖНОСТЬ ТАКОЙ ПОВРЕЖДЕНИЕ.

Благодарности

Разработка Primer3 и Primer3 веб-сайт был профинансирован Медицинский институт Говарда Хьюза и по Национальные институты здоровья, Национальный центр исследования генома человека. по грантам R01-HG00257 (Дэвиду С. Пейджу) и P50-HG00098 (Эрику С. Лендеру).

Мы с благодарностью признаем поддержку Корпорация цифрового оборудования, которые предоставили Альфы, которые использовались для многих разработки Primer3 и Centerline Software, Inc., чей TestCenter memory-error, -leak и средство проверки тестового покрытия мы регулярно используем для обнаружения и исправления скрытых в противном случае ошибки в Primer3.


Оригинальный дизайн этого сайта с подборкой праймеров Ричард Резник , который также является автором документации этого сайта.
Веб-программное обеспечение, предоставленное Стив Розен [email protected] а также Институт Уайтхеда / Центр исследований генома Массачусетского технологического института.
Последнее изменение: Вт, 25 августа, 19:53:27 EDT

Addgene: Protocol — How to Design Primers

Primer Design for PCR

Олигонуклеотидные праймеры необходимы при проведении реакции ПЦР.Необходимо разработать праймеры, комплементарные матричной области ДНК. Они синтезируются химическим путем путем соединения нуклеотидов. При добавлении нуклеотида по одному необходимо выборочно блокировать и многократно разблокировать реактивные группы на нуклеотиде. Основное свойство праймеров состоит в том, что они должны соответствовать последовательностям в матричной молекуле (должны быть комплементарны цепи матрицы). Однако необязательно, чтобы праймеры полностью соответствовали цепи матрицы; однако важно, чтобы 3 ’конец праймера полностью соответствовал цепи матричной ДНК, чтобы можно было продолжить удлинение.Обычно гуанин или цитозин используют на 3 ’конце, а 5’ конец праймера обычно имеет участки в несколько нуклеотидов. Кроме того, оба 3 ’конца гибридизированных праймеров должны указывать друг на друга.

Размер грунтовки также очень важен. Короткие праймеры в основном используются для амплификации небольшого простого фрагмента ДНК. С другой стороны, длинный праймер используется для амплификации образца геномной ДНК эукариот. Однако праймер не должен быть слишком длинным (> 30-членные праймеры) или слишком коротким.Короткие праймеры производят неточный, неспецифический продукт амплификации ДНК, а длинные праймеры приводят к более медленной скорости гибридизации. В среднем фрагмент ДНК, который необходимо амплифицировать, должен иметь размер в пределах 1–10 кБ.

Структура грунтовки должна быть относительно простой и не содержать внутренней вторичной структуры, чтобы избежать внутреннего складывания. Также необходимо избегать отжига праймер-праймер, который создает димеры праймеров и нарушает процесс амплификации. При разработке, если вы не уверены в том, какой нуклеотид поместить в определенное положение внутри праймера, можно включить более одного нуклеотида в это положение, называемое смешанным сайтом.Можно также использовать молекулярную вставку на основе нуклеотидов (инозин) вместо обычного нуклеотида для более широких возможностей спаривания.

Принимая во внимание вышеизложенную информацию, грунтовки обычно должны иметь следующие свойства:

  • Длина 18-24 баз.
  • 40-60% содержание G / C
  • Начало и конец с 1-2 парами G / C
  • Температура плавления (Tm) 50-60 ° C
  • Пары праймеров должны иметь Tm в пределах 5 ° C друг от друга.
  • Пары праймеров не должны иметь дополнительных участков

    Примечание: Если вы будете включать сайт рестрикции на 5 ’конце вашего праймера, обратите внимание, что перед ферментом должен быть добавлен« зажим »из 3-6 пар оснований для эффективного расщепления (например,грамм. GCGGCG-сайт рестрикции-ваша последовательность).

Как создавать грунтовки | Бенчлинг

Дизайн праймеров с использованием инструментов молекулярной биологии Benchling

Дизайн праймера

может показаться простым; в конце концов, праймеры имеют длину менее 30 пар оснований! Но с учетом такого количества чувствительных характеристик праймеров, которые необходимо учитывать, а также огромного количества праймеров, которые может потребоваться создать исследователю, может быть сложно поддерживать процесс организованным и отслеживаемым.

Приложение

Benchling’s Molecular Biology позволяет создавать интеллектуальные праймеры вручную или автоматически с помощью мастера. С помощью интеллектуальных систем разрешений вы можете указать, какие команды имеют доступ к каким проектам. Затем команды могут сохранять учебники в пользовательских или общих библиотеках для дальнейшего использования или дальнейшего сотрудничества и разработки. В инструменте праймеров Benchling сканирует и обнаруживает сайты связывания в последовательностях, что позволяет точно прикреплять праймеры, запускать in silico PCR и использовать продукты PCR для планирования критических задач, таких как методы расщепления и лигирования, клонирование Гибсона и сборка Golden Gate.

Приложение представляет собой мощный инструмент, который используется не только для разработки праймеров. С более чем 10 инструментами на одной унифицированной платформе вы также можете создавать аннотации последовательностей, выполнять выравнивание и разрабатывать направляющие РНК (gRNA) CRISPR. Вы также можете легко обмениваться проектами и сохранять их, поскольку инструмент интегрирован с облачными блокнотами и реестром Benchling.

Конструктивное проектирование CRISPR Клонирование
  • — Клонирование на основе ограничений
  • — Сборка Gibson и Golden Gate
  • — Массовая сборка
  • — Оптимизация и перевод кодонов
  • — Дизайн гид РНК
  • — попадание в створ / вне мишени
  • — Шаблоны HR
  • — Плазмида в сборе
  • — Поиск ферментов
  • — Виртуальные дайджесты
  • — Сайты разрезания ферментов
  • — Библиотека лестниц
  • — Списки ферментов
Выравнивание последовательности Анализ аминокислот / белков Визуализация последовательности
  • — Выравнивание по шаблонам
  • — Согласование консенсуса
  • — Массовое автоматическое выравнивание
  • — Аминокислотные выравнивания
  • — Автозаполнение переводов
  • — Схемы нумерации антител
  • — Идентификация CDR
  • — Идентификация объекта PTM
  • — Плазмидная карта
  • — Настройка ORF
  • — Аннотации
  • — Массовые автоаннотации
  • — Поиск последовательности

Грунтовки для дизайна с Benchling

С помощью Benchling вы можете легко разрабатывать и анализировать праймеры в режиме онлайн.Дизайн праймеров для количественной ПЦР, ПЦР, клонирования и секвенирования. Некоторые основные моменты включают:

  • Быстро визуализируйте сайты связывания праймеров на интересующей последовательности и отслеживайте последовательности, для которых используются праймеры.
  • Легко прикрепите один праймер к последовательности или соедините их попарно. Файлы последовательностей праймеров, называемые в Benchling «олигонуклеотидами», содержат список всех последовательностей, к которым они когда-либо были присоединены, что обеспечивает полную прослеживаемость вашей библиотеки праймеров.

В Benchling можно создавать праймеры вручную или с помощью Primer Wizard.Если ваш праймер уже разработан, вы также можете легко найти любые существующие праймеры для присоединения к вашей последовательности или импортировать олигонуклеотиды в Benchling. Давайте посмотрим, на что способен инструмент Benchling для создания учебников.

Рисунок 6. Расчет праймера в Benchling

Ручной дизайн грунтовки

Вы можете создать праймеры вручную на платформе Benchling из последовательностей, которые уже используются в вашей организации. Чтобы создать праймеры вручную, выделите область матричной ДНК на карте последовательностей, выбрав нужный диапазон, щелкнув правой кнопкой мыши и выбрав создание прямого или обратного праймера.

Рисунок 7а. Ручное создание праймеров в Benchling

Затем на вкладке «Дизайн» вы можете сфокусироваться на основаниях выбранной последовательности, обозначить выступ и включить сайты разреза рестрикционным ферментом.

Рисунок 7b. Ручное создание праймеров в Benchling

После проектирования быстро проверьте праймеры автоматически на вкладке «Проверка». В интерфейсе доступно следующее:

  • Значения свободной энергии Гиббса для гомодимеров и мономеров
  • Температура плавления и содержание ГХ
  • Схемы вторичной структуры димеров

Вы даже можете настроить термодинамические параметры, чтобы изменить способ вычисления температуры плавления, щелкнув значок гаечного ключа.После завершения проектирования присвойте праймеру имя и сохраните его в библиотеке праймеров.

Рисунок 7c. Ручное создание праймеров в Benchling

Wizard Primer Design

Вы также можете создавать праймеры с помощью мастера праймеров, который автоматически создает праймеры для вашей целевой последовательности с помощью технологии Primer3. Benchling поддерживает разработку трех основных типов праймеров: ПЦР, количественная ПЦР и праймеры для секвенирования. На каждом шаге мастера настройте необходимые параметры. Отрегулируйте содержание ГХ, температуру плавления, длину, зажим ГХ, длину ампликона и другие параметры.

Простой поиск, импорт и прикрепление существующих праймеров

Если ваш праймер уже разработан, с помощью Benchling вы также можете быстро искать, импортировать и прикреплять любые существующие праймеры.

Найдите существующие праймеры, которые связываются с вашей последовательностью, на основе определенных параметров праймера, таких как длина, температура плавления и количество допустимых несовпадений, и Benchling покажет их сохраненные местоположения. Выберите нужные праймеры и просмотрите их привязанными к карте последовательностей.

В качестве альтернативы можно импортировать праймеры с помощью функции Import Oligios в Benchling и быстро добавить любые из уже существующих праймеров в вашей организации.

Рис. 8. Расчет праймера в Benchling с мастером

Это особенно полезно, если вы переносите какие-либо праймеры в Benchling из другого инструмента, такого как Vector NTI, Snapgene или Geneious. Тестирование поддерживает различные типы файлов последовательностей и переносит любые аннотации и теги, связанные с последовательностями.

Наконец, после создания или сохранения вы можете присоединить праймеры к выбранной последовательности. Все сохраненные праймеры перечислены в меню инструмента праймеров для любого файла последовательности, с которым вы работаете.

Присоединение существующих праймеров в Benchling позволяет автоматически находить существующие праймеры, которые связываются с вашей последовательностью, быстро визуализировать сайты связывания праймеров и просматривать все файлы последовательностей, к которым был присоединен любой олигофайл (праймер).

Отправить праймеры на NCBI Blast

С помощью Benchling пользователь может легко проверить специфичность праймеров, отправив олигонуклеотиды через инструмент праймеров NCBI Blast. Оказавшись внутри Benchling, просто щелкните и перетащите карту последовательностей, чтобы выделить праймер (или любую другую интересующую последовательность), щелкните правой кнопкой мыши и отправьте в NCBI Blast.Последовательность отправляется в программу BLASTN, которая выполняет поиск нуклеотидов.

Рис. 9. Инструмент для струйной очистки NCBI Primer в Benchling

NCBI предоставляет инструмент NCBI Primer Blast для создания праймера, но он требует, чтобы вы каждый раз вводили или копировали / вставляли олиго-последовательность для создания праймера. И после создания вы должны постоянно импортировать разработанный праймер в Benchling или в свой инструмент молекулярной биологии. Простое использование Benchling предоставит вам одно центральное место для всего рабочего процесса, в то же время позволяя легко отправлять свои олиго в инструмент для праймеров NCBI.

Создание пользовательских библиотек праймеров

Делитесь пользовательскими библиотеками праймеров со своими коллегами, чтобы вам никогда не приходилось задаваться вопросом, какие праймеры уже были разработаны и использовались в прошлом. Проекты основаны на определенных разрешениях, что позволяет командам настраивать собственные библиотеки по мере необходимости. Возможность записывать и публиковать праймеры — лишь одна из причин, почему Eligo Bioscience любит Benchling.

In silico PCR в Benchling

С помощью Benchling пользователь может легко проверить специфичность праймеров, отправив олигонуклеотиды через него. После разработки праймеров вы можете запустить ПЦР in silico с помощью Benchling.Просто выберите прямой и обратный праймеры, свяжите их в пару и создайте продукты ПЦР двумя щелчками мыши.

Рисунок 10. Выполнение ПЦР in silico в Benchling

После разработки функциональных праймеров и амплификации продуктов ПЦР (ампликонов) платформа Benchling может продолжить моделирование последующих процедур, таких как расщепление и лигирование, конструирование плазмид, трансфекция и методы клонирования, такие как сборка Гибсона и Golden Gate.

Пользователь может «@» упомянуть любой из продуктов ПЦР, дайджестов, плазмид или файлов праймеров непосредственно в записи Notebook и автоматически зарегистрировать их в Benchling Registry.Свяжите любую из этих процедур in silico с фактическим образцом, используемым в лаборатории, с помощью Benchling Inventory. Связывая эти проекты с физическими продуктами в лаборатории, Benchling предоставляет вам центральное место для доступа ко всем экспериментальным данным и обмена ими с разными учеными и группами.

Бесплатные инструменты для создания учебников для начинающих

Benchling for Academics предлагает Benchling Molecular Biology — включая инструменты для разработки учебников, дизайн CRISPR gRNA, выравнивания и многое другое — и Benchling Notebook бесплатно для студентов, аспирантов, аспирантов и любых других ученых.

С более чем 180 000 ученых, использующих Benchling по всему миру, мы инвестируем в формирование следующего поколения биологов. Доступ к бесплатным, современным и удобным инструментам позволяет академическому сообществу быстрее делать новаторские открытия и тратить меньше времени на записи в бумажных блокнотах, поиск данных с помощью отключенных инструментов и выполнение ручного ввода данных, подверженного ошибкам. Вот несколько полезных советов для ученых от пользователей Benchling for Academics о том, как они используют этот инструмент для повышения эффективности своих исследований.

Benchling for Academics также полезен профессорам и учителям естественных наук. Теперь инструкторы могут столкнуться с дополнительной проблемой преподавания курсов удаленно из-за пандемии коронавируса. Без доступа к курсам влажных лабораторий студентам может быть сложно понять концепции, лежащие в основе методов молекулярной биологии. Но при правильном подходе профессора и преподаватели могут использовать Benchling для адаптации лабораторных курсов для виртуального обучения.

Запросить демонстрацию Benchling

Если вы хотите узнать больше о том, что Benchling может предложить вашим научным коллективам, запросите демонстрацию на Benchling.com / request-demo.

Дизайн грунтовки

— это только начало того, что Benchling предлагает своим клиентам. Benchling — это полностью интегрированная платформа исследований и разработок в области наук о жизни, которая поддерживает продуктивность ученых, отслеживание образцов, управление процессами и аналитику. Benchling является лидером в области облачной информатики для исследований и разработок в области наук о жизни, которую используют более 270 000 ученых по всему миру из транснациональных фармацевтических корпораций, ведущих биотехнологических компаний и крупных исследовательских институтов.

PCR Primer Дизайн Советы — За Bench

*

Выберите страну / regionUnited StatesCanadaAfghanistanAlbaniaAlgeriaAmerican SamoaAndorraAngolaAnguillaAntarcticaAntigua и BarbudaArgentinaArmeniaArubaAustraliaAustriaAzerbaijanBahamasBahrainBangladeshBarbadosBelarusBelgiumBelizeBeninBermudaBhutanBoliviaBosnia и HerzegovinaBotswanaBouvet IslandBrazilBritish Индийский океан TerritoryBrunei DarussalamBulgariaBurkina FasoBurundiCambodiaCameroonCape VerdeCayman IslandsCentral африканских RepublicChadChileChinaChristmas IslandCocos (Килинг) IslandsColombiaComorosCongoCongo, Демократическая Республика ofCook IslandsCosta RicaCote D’IvoireCroatiaCubaCyprusCzech RepublicDenmarkDjiboutiDominicaDominican RepublicEast ТиморЭквадорЕгипетЭль-СальвадорЭкваториальная ГвинеяЭритреяЭстонияЭфиопияФолклендские (Мальвинские) острова Фарерские островаФинляндияФинляндияМорская Республика МакедонияФранцияФранцузская ГвианаФранцузская ПолинезияФранцузские Южные территорииГранцияГамбияГрузияГерманияГанаГана loupeGuamGuatemalaGuineaGuinea-BissauGuyanaHaitiHeard и McDonald IslandsHoly Престол (Ватикан) HondurasHong KongHungaryIcelandIndiaIndonesiaIran (Исламская Республика) IraqIrelandIsraelItalyJamaicaJapanJordanKazakstanKenyaKiribatiKorea, Корейские Народно-Демократической RepKorea, Республика ofKuwaitKyrgyzstanLao Народный Демократической RepLatviaLebanonLesothoLiberiaLibyan Arab JamahiriyaLiechtensteinLithuaniaLuxembourgMacauMadagascarMalawiMalaysiaMaldivesMaliMaltaMarshall IslandsMartiniqueMauritaniaMauritiusMayotteMexicoMicronesia, Федеративные StatesMoldova, Республика ofMonacoMongoliaMontserratMoroccoMozambiqueMyanmarNamibiaNauruNepalNetherlandsNetherlands AntillesNew CaledoniaNew ZealandNicaraguaNigerNigeriaNiueNorfolk IslandNorthern Mariana IslandsNorwayOmanPakistanPalauPanamaPapua Нового GuineaParaguayPeruPhilippinesPitcairnPolandPortugalPuerto RicoQatarReunionRomaniaRussian FederationRwandaSaint HelenaSaint Китс и НевисСент-ЛюсияСент-Пьер и МикелонСамоаСан-МариноСао Томе и Принсипи Саудовская Аравия abiaSenegalSeychellesSierra LeoneSingaporeSlovakiaSloveniaSolomon IslandsSomaliaSouth AfricaSpainSri LankaSth Georgia & Sth Sandwich Институт социальных Винсент и GrenadinesSudanSurinameSvalbard и Ян MayenSwazilandSwedenSwitzerlandSyrian Arab RepublicTaiwan, провинция ChinaTajikistanTanzania, Объединенная Республика ofThailandTogoTokelauTongaTrinidad и TobagoTunisiaTurkeyTurkmenistanTurks и Кайкос IslandsTuvaluUgandaUkraineUnited Арабские EmiratesUnited KingdomUruguayUS Малые отдаленные IslandsUzbekistanVanuatuVenezuelaVietnamVirgin острова (Британские) Виргинские острова (U.S.) Острова Уоллис и Футуна, Западная Сахара, Йемен, Югославия, Замбия, Зимбабве,

Праймер для разработки дегенеративных грунтовок

Для тех из нас, кто работает с Mus musculus или Homo sapiens , чтобы назвать пару видов, несколько кликов на сайте UCSC Genome Bioinformatics или Ensembl предоставят вам полную и точную последовательность ДНК для любого аннотированного гена в геноме. . Однако эта роскошь свойственна не всем видам; многие из которых остаются незамеченными.Так как же нам раскрыть генетический код нашего любимого модельного организма в нашем гене или интересующей области?

Вырождение последовательности

В большинстве случаев помощь будет приходить от других близкородственных видов, для которых известна генетическая последовательность или белковый код интересующего нас гена. Гомологичные гены или аминокислотные последовательности могут быть выровнены из нескольких видов и могут быть идентифицированы консервативные и неконсервативные области между видами.

Если нам известен аминокислотный код родственных организмов, мы можем работать в обратном направлении, чтобы разработать ряд «вырожденных» праймеров с множеством итераций, чтобы найти набор, который комплементарен нашей «неизвестной» последовательности, и получить продукт, который можно амплифицировать.

Определение вырожденных праймеров

Вырожденный праймер определяется как: «Смесь олигонуклеотидных последовательностей, в некоторых положениях которой содержится ряд возможных оснований, что дает популяцию праймеров со схожими последовательностями, охватывающими все возможные комбинации нуклеотидов для данной белковой последовательности» (Iserte 2013 ) . Например:

ATCGTT [ GC ] AAGT [ AGC ] ATC

относится к серии праймеров, в которых седьмой и двенадцатый нуклеотиды являются вырожденными.Степень вырожденности определяется количеством различных комбинаций праймеров в смеси. В приведенном выше примере значение вырожденности составляет шесть .

Используя систему Международного союза теоретической и прикладной химии (IUPAC) для вырожденных оснований (таблица 1), мы можем вставить однобуквенный код, представляющий наш неизвестный регион. В приведенном выше примере мы использовали бы «S» вместо GC и «V» вместо AGC.

Конструирование вырожденных праймеров

Чтобы создать свой собственный набор вырожденных праймеров, следуйте некоторым основным рекомендациям:

1) Совместите несколько аминокислотных последовательностей с помощью бесплатного онлайн-программного обеспечения, такого как EBIClustalO.
2) Нацельтесь на область длиной примерно 200-500 пар оснований для оптимальной амплификации PCR.
3) Расположите прямой и обратный праймеры в более консервативных областях — чем менее вырожденными, тем дальше они могут быть друг от друга.
4) Включите в праймеры от 6 до 7 аминокислот, что составляет ~ 15-20 пар оснований.
5) Постарайтесь включить аминокислоты метионин и триптофан, которые кодируются одним кодоном (трехбуквенный нуклеотидный код), и избегайте аминокислот лейцин, серин и аргинин, каждая из которых может кодироваться шестью комбинациями кодонов (таблица 2).
6) Для последующих процедур клонирования и увеличения длины праймера (и, следовательно, температуры отжига) добавьте 5 ’хвост (6-9 пар оснований), содержащий сайт рестрикционного фермента.
7) Если наблюдается полное вырождение (нет совпадений среди каких-либо данных видов), рассмотрите возможность использования инозина основания (структурно подобного гуанину), поскольку оно может спариваться с любым из четырех оснований, хотя предпочтительно будет связываться с цитозином. В качестве альтернативы вставьте N для любого основания, чтобы обеспечить эквимолярные концентрации каждого основания в этом положении в смеси праймеров.
8) Избегайте вырождения на 3 ’конце (это не лучшее место для вставки инозина).

В зависимости от цели баланс между специфичностью и эффективностью праймера может быть изменен путем изменения вырожденности праймера. Например, чем более вырождены праймеры, тем менее специфичным будет отжиг; тем не менее, снижение вырожденности даст больше возможностей для идентификации неизвестных вариантов.

Помощь есть

К счастью, как и в случае с базовым дизайном грунтовки, есть помощь для разработки дегенеративных грунтовок.Существует ряд онлайн-и загружаемых программ, помогающих в дизайне. На основе введенной последовательности программное обеспечение сгенерирует минимальное количество вырожденных праймеров при сохранении оптимальных требований ПЦР. Некоторые часто используемые программы, которые стоит попробовать, включают iCODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primers), NCBI Primer-BLAST или HYDEN (HighlY DEgeNerate primers) .

Другие применения дегенеративных грунтовок

Помимо определения последовательности, вырожденные праймеры могут иметь множество применений.К ним относятся:

  • Различение разных аллелей (родительских копий) с использованием простого несоответствия оснований на 3 ’конце

— определение дикого типа по мутантным аллелям

— определение исходных аллелей (генотипирование)

— неизбежный однонуклеотидный полиморфизм (SNP). Например, SNP A / G можно заменить на R

.

— сайт CpG (динуклеотид CG), присутствующий в ДНК, превращенной в бисульфит, может быть или не быть метилирован, поэтому остаток C может быть C или T.Заменить на Y.

Для чего вы используете дегенеративные грунтовки?

Список литературы

Iserte, J.A., Stephan, B.I., Goni, S.E., Borio, C.S., Ghiringhelli, P.D., Lozano, M.E. (2013) Конструирование вырожденных праймеров, специфичных для семейства: инструмент для конструирования консенсусно вырожденных олигонуклеотидов. Biotechnol Res Int 2013: 38364

Вам это помогло? Тогда поделитесь, пожалуйста, со своей сетью.

Улучшенный дизайн праймеров для метагеномических приложений за счет повышения таксономической различимости | BMC Proceedings

Начнем с некоторых необходимых обозначений.Обозначим через S набор (базу данных) последовательностей в алфавите Σ = {A, C, G, T, R, Y, S, W, K, M, B, D, H, V, N}, что соответствует буквы, используемые в коде IUPAC (http://www.bioinformatics.org/sms/iupac.html). Каждая буква в Σ соответствует набору оснований алфавита ДНК {A, C, G, T}. Например, буква H соответствует набору {A, C, T}. Каждая буква Σ имеет значение вырождения , что равняется мощности ее базового набора. Обозначим это DEG ( a ) для a∈Σ.Вырождение последовательности S определяется как произведение значений вырождения каждой из ее букв. Более формально, DEG (S) = ∏k = 1lDEG (S (k, 1)), где S ( j , l ) является непрерывной подпоследовательностью длиной l , начиная с позиции j в S . Например, пусть S 1 = AAGGATCG, S 2 = WGSANS и S 3 = AGGSTD, затем DEG ( S 1 ) = 1, DEG ( S 2 ) = 32 и ГРАДУС ( S 3 ) = 6.Последовательность называется невырожденной , если ее вырожденность равна 1. Таким образом, вырожденность последовательности является мерой количества различных невырожденных последовательностей, которые она представляет (или соответствует).

Соответствие . Говорят, что буква p из последовательности праймера соответствует букве t целевой последовательности, если набор оснований, соответствующий t , является подмножеством набора оснований, соответствующих p. . Таким образом, например, если целевая основа — R, а основа праймера — D, тогда MATCH (D, R) = true , а match (R, D) = false .С другой стороны, MATCH (G, H) = MATCH (H, G) = false . Распространяя это определение на последовательности, говорят, что последовательность праймера P длиной j соответствует целевой последовательности T , если существует местоположение l , так что буквы P совпадают с соответствующими буквами Т ( Дж, л). Например, для упомянутых выше последовательностей MATCH ( S 2 , S 3 ) = false , а MATCH ( S 2 , S 1 ) = true с S 2 соответствует подпоследовательности S 1 длины 6, начиная с позиции 2.Биологически, если последовательность праймера совпадает с последовательностью-мишенью , то последовательность праймера будет гибридизоваться с последовательностью-мишенью в месте совпадения.

Вырожденные коды, такие как S = {C, G}, W = {A, T} и N = {A, C, G, T}, означают разные вещи в разных контекстах. Вырожденный код N в базе данных (например, RDP) означает, что значение этой базы точно не определено. Таким образом, N означает, что основание представляет собой A, C, G или T, и любой выбор основания (кроме N) для праймера в этом положении может не совпадать.С другой стороны, вырожденный код в праймере означает, что все возможные основания присутствуют в праймере в этом положении. Таким образом, N означает, что основание представляет собой A и C, G и T, то есть используются разные копии праймера с разными основаниями в этом положении. Следовательно, он будет соответствовать любой букве в соответствующем целевом местоположении.

Обычный . Две буквы из Σ называются ОБЩИМИ, если наборы оснований, которые они представляют, имеют непустое пересечение. Так, например, ОБЩИЙ (R, D) = ИСТИНА, а ОБЩИЙ (G, H) = ложный .Определение может быть расширено до двух общих последовательностей следующим образом: две последовательности называются ОБЩИМИ, если каждая буква одной из последовательностей является общей с соответствующей буквой из другой последовательности.

Расчетные параметры оптимальных вырожденных праймеров . Как упоминалось ранее, реакция ПЦР требует, чтобы праймеры выполняли ряд условий, чтобы она работала хорошо. Следующие параметры и их ограничения были собраны из различных руководств по проектированию.(Например, см. Http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html.) В дальнейшем мы будем называть их Правилами разработки оптимальных праймеров .

(1) SELFDIMER ( P ) определяется как длина самой длинной непрерывной ОБЩЕЙ подпоследовательности между праймером P и его обратным комплементом. Хороший дизайн грунтовки требует, чтобы это количество было минимальным.

(2) PRIMERDIMER ( F, R ) определяется как длина самой длинной непрерывной ОБЩЕЙ подпоследовательности между прямым ( F ) и обратным ( R ) праймерами.Это количество должно быть минимизировано.

(3) ДЛИНА АМПЛИКОНТА ( F, R ) — длина последовательности, которая начинается с F и заканчивается R . Длина ампликона определена в диапазоне 150-600 п.н. Нижний предел предотвращает амплификацию консервативных областей. Верхний предел определяется текущей длиной чтения, поддерживаемой технологиями секвенирования.

(4) RUNLENGTH ( P ) — максимальное количество последовательных вхождений одного и того же основания из набора {A, C, G, T}.Таким образом, для праймера U336R в таблице 1 подпоследовательность, окрашенная в красный цвет, имеет RUNLENGTH (U336R) = 6.

(5) CG% ( P ) — процент оснований {C, G} в P. Если DEG ( P ) = 1, или если присутствуют только вырожденные основания S или W, то в вычислении CG% нет двусмысленности. Поскольку другие вырожденные основания вызывают неоднозначность в подсчете, мы получаем диапазон значений [MINCG% ( P ), MAXCG% ( P )]. Хороший дизайн грунтовки требует, чтобы CG% ( P ) составлял от 50 до 65.На практике это ограничение можно немного ослабить.

(6) Хотя в литературе существует множество методов, TM ( P ) вычисляется с помощью Basic T м уравнение (см. Http://www.promega.com/techserv/tools/biomath/calc11.htm): T м ( P ) = 64,9 + 41 * (C G % ( P ) — 16,4) / длина ( P ). Если DEG ( P ) = 1 или если присутствуют только вырожденные основания S или W, то в приведенном выше вычислении нет двусмысленности.Как и в случае CG%, если в последовательности праймера присутствуют другие вырожденные основания, тогда возможен диапазон значений, который обозначается [MINTM ( P ), MAXTM ( P )]. Хорошая конструкция грунтовки требует, чтобы весь диапазон находился в пределах от 55 ° до 65 °. Также требуется, чтобы RANGETM ( P ) = MAXTM ( P ) -MINTM ( P ) не превышало 5 °. Опять же, на практике допускается небольшое отклонение от этих условий.

Вместо того, чтобы позволить произвольной последовательности быть кандидатом праймеров, мы определяем еще несколько терминов, которые помогают нам сузить область поиска для наших праймеров-кандидатов.

Жизнеспособный грунт . Жизнеспособный праймер представляет собой последовательность, которая удовлетворяет приведенным выше правилам оптимального конструирования праймеров.

Обычная жизнеспособная грунтовка для ℋ. Обычный жизнеспособный праймер для мультимножества последовательностей ℋ является жизнеспособным праймером, если он совпадает с по крайней мере мин Поддерживает количество последовательностей в ℋ.

Производная . Последовательность P получается из последовательности T , если MATCH ( P , T ) = true .(Например, P 1 = AWGCT является производной от T = ATGCT, но P 2 = ATGGT — нет.)

Amplicon из последовательности S с парой праймеров ( F , R ). Ампликон A из последовательности S является непрерывной подпоследовательностью S , определяемой парой жизнеспособных праймеров ( F , R ). A должен начинаться с подпоследовательности, которая соответствует обратному комплементу прямого праймера F , и должна заканчиваться подпоследовательностью, которая соответствует обратному праймеру R .

Последовательность контрольной цели T . Последовательность T из базы данных последовательностей S называется эталонной последовательностью-мишенью, если прямой и эталонный праймеры происходят от T .

Описание проблемы

Основная задача жизнеспособного праймера состоит в том, чтобы сопоставить как можно больше последовательностей из целевой базы данных. Для пар праймеров важно максимизировать количество последовательностей, которые соответствуют и праймерам.В таких приложениях, как метагеномика, где ампликоны секвенируются, а затем используются для идентификации организма, от которого они произошли, третье требование состоит в том, чтобы ампликоны, генерируемые праймерами, были однозначно различимы.

Проблема проектирования вырожденной грунтовки . Для данного набора параметров P, набора последовательностей S и эталонной целевой последовательности T∈S найдите жизнеспособную пару праймеров ( F , R ), которая соответствует T , для которой количество различимых ампликонов, генерируемых его праймеры ( F , R ) для последовательностей в S максимизированы.

Другими словами, учитывая базу данных S (например, RDP), эталонную последовательность T (например, E. coli ) и значения для параметров проекта, P, включая MAXSELFDIMER, MAXPRIMERDIMER, MAXRUNLENGTH, MINCG% , MAXCG%, MINTM и MAXTM, создают набор жизнеспособных прямых и обратных пар вырожденных праймеров с максимальным количеством уникальных ампликонов.

Описание алгоритма

Algorithm1SELECT PRIMER CANDIDATES ¯ Вход: S: база данных последовательностей; T: последовательность; P: ¯ параметры дизайна праймера Выход: ℱ / ℛ: список праймеров всех возможных вырожденных прямых или обратных праймеров ℱ = ∅forpos = 1: длина (T) дофорлен = P.MINLENGTH: P.MAXLENGTHdoP = T (pos, len) ifISVIABLE (P, P) thenℋ = ∅; ℋ ← FINDBESTVALIDMATCH (S, P, P) ℱ ← DEVELOPDEGPRIMER (ℋ, P) endifendforendfor_

Контрольная последовательность T гарантирует, что количество возможных последовательностей праймеров является конечным. Наблюдение ниже еще больше сокращает пространство поиска.

Наблюдение 1 Если праймер P 1 нежизнеспособен, то праймер P 2 , полученный из P 1 , также не пригоден .

Также с учетом грунтовок P 1 , P 2 , так что DEG ( P 1) DEG ( P 2 ) и MATCH ( P 1 , P 2 ) = true , тогда (a) САМОДАЙМЕР ( P 1 ) САМОДАЙМЕР ( P 2 ), (b) ТЕМПЕРАТУРА ( P 1 ) ТЕМПЕРАТУРА ( P 2 ), (c) CG% ( P 1 ) CG% ( P 2 ) и (d) ПРОДОЛЖИТЕЛЬНОСТЬ ( P 1 ) ДЛИНА РАБОТЫ ( P 2 ).

Сканирование возможных прямых и обратных праймеров . Чтобы сделать поиск более эффективным, мы сосредотачиваемся на последовательностях праймеров, полученных из последовательности-мишени . Наблюдение 1 также используется для удаления нежизнеспособных праймеров-кандидатов.

Алгоритм SELECTPRIMERCANDIDATES, показанный здесь, разрабатывает набор ℱ жизнеспособных общих вырожденных прямых праймеров, которые соответствуют всем жизнеспособным праймерам P из эталонной последовательности T и базы данных последовательностей S.Аналогичный дизайн выполняется для создания набора жизнеспособных общих обратных праймеров ℛ. Во-первых, для каждого жизнеспособного праймера из T функция FIND-BESTVALIDMATCH генерирует набор из уникальных наилучших действительных совпадений в S. Обратите внимание, что не все целевые последовательности вносят вклад в ℋ. Некоторые целевые последовательности могут не иметь действительного совпадения или уникального наилучшего действительного совпадения для соответствующей подпоследовательности T .

Algorithm2DEVELOPDEGPRIMER ¯ Вход: ℋ: набор совпадений; P: параметры дизайна праймера ¯ Выход: D: список вырожденных праймеров D = ∅; cnt = 0profileMtx = CREATEPROFILEMTX (ℋ) ifINITCHECK (profileMtx, P) thencurrentPrimer = INITPRIMER (profileMtx) whileISVIABmer = Primer.REMOVEDEGMATCH (degPrimer) ifcnt≥minSupport thenAdd degPrimer в DendifprofileMtx = CREATEPROFILEMTX (ℋ) PQ ← записи profileMtx с приоритетом entrycurrentPrimer = degPrimer∪PQ.popmer (), в то время как current ISVIABrirentQ.popmer () пока! degPrimer∪PQ.pop () end whileend Whileendif_

Уникальное наилучшее допустимое соответствие между праймером и последовательностью . Соответствие между жизнеспособным праймером P и последовательностью S i является действительным , если существует непрерывная подпоследовательность в S i такой же длины, что и P , и не более log 2 (MAXDEGENERACY) не соответствует P .Если существует только одно действительное соответствие между P и S i , имеющий наименьшее количество несовпадений, то это уникальное наилучшее действительное совпадение .

Алгоритм DEVELOPDEGPRIMER разрабатывает набор из жизнеспособных общих праймеров , соответствующих входному мультимножеству ℋ. Из выровненного набора совпадений ℋ мы создаем матрицу подсчета частот для каждой позиции. Если самая высокая частота в позиции (столбце) в выравнивании меньше, чем minSupport , то эта позиция в праймере должна быть вырожденной.Сначала мы проверяем, что количество позиций, требующих вырождения, не превышает log 2 (MAXDEGENERACY). Если это так, то граница вырожденности будет нарушена, и мы выйдем без вычисления общего вырожденного праймера . В противном случае мы конструируем исходный вырожденный праймер, degPrimer , с каждым из его оснований, установленным на основание, которое чаще всего встречается в этом положении. Если исходный вырожденный праймер не является жизнеспособным праймером, мы выходим, так как его производные не должны рассматриваться при наблюдении 1.

Algorithm3DESIGNPRIMERPAIR ¯Вход: S: база данных последовательностей; ℱ, ℛпередачи, наборы обратных праймеров из SelectPrimerCandidates; параметры конструирования пар праймеров Выход: список пар праймеров; AP список пар пар праймеров A = ∅ℱ = SORTPERRGN (ℱORTPER), ℛ (ℛ) fori = 1: numRgns (ℱ), j = 1: numRgns (ℛ) doA ← MATCHBESTPERRGNFR (ℱ (i), ℛ (j), P) endforA, AP ← FINDDISTINGUISHTOTAL (S, A) _

Начало из начального праймера мы удаляем все записи ℋ, которые соответствуют текущему праймеру. Чтобы увеличить количество совпадений в ℋ, мы используем жадный метод для итеративного увеличения вырожденности праймера, по одному основанию за раз, следующим образом.На каждой итерации из оставшихся последовательностей в мы восстанавливаем матрицу подсчета частот, сохраняя все позиции, которые еще не совпадают с текущим праймером, в порядке отсчета частоты наивысшей частоты. Мы решили увеличить вырождение основы с наибольшей частотой, при этом следя за тем, чтобы новый праймер оставался жизнеспособным. Связи нарушаются в пользу основания, для которого повышенная вырожденность вызывает наименьшее увеличение общей вырожденности последовательности. Когда новый общий жизнеспособный праймер обнаруживается, он добавляется к набору праймеров-кандидатов ℱ.

Алгоритм DESIGNPRIMERPAIR берет набор жизнеспособных прямых праймеров и набор жизнеспособных обратных праймеров, группирует каждый набор по подобластям, сортируя каждую группу по количеству совпадений в базе данных. Чтобы обеспечить лучшее спаривание праймеров с точки зрения различимости, каждая консервативная область далее подразделяется на подобласти, определяемые положением начала праймера. Отсортированные списки прямых и обратных праймеров сканируются, чтобы выбрать пару с максимальным количеством одновременных совпадений в базе данных, которая соответствует оптимальным правилам проектирования.Когда у нас есть пары праймеров и их количество совпадений в базе данных, мы сосредотачиваемся на различимости ампликонов.

Posted in Разное

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *