Праймер что это такое и как пользоваться: зачем нужен и как пользоваться

Праймер что это такое и как пользоваться: зачем нужен и как пользоваться

19.12.1982

Содержание

Что такое праймер и как им пользоваться?

Праймер – это база под макияж. Использование праймера сделает макияж более устойчивым, выровняет цвет лица, скроет неровности и придаст коже здоровый вид и сияние.

Использование праймера кардинально изменит ваше представление о макияже. Тональное средство, нанесенное поверх базы, смотрится аккуратнее и держится весь день. Вы можете забыть, что такое «поплывший» макияж.

Это чудо-средство предназначено для того, чтобы создать гладкую и ровную базу для привычного макияжа и подготовить кожу к нанесению основы. База для макияжа относительно новая продукция на косметическом рынке. Ее можно назвать одним из секретов красоты, которые помогают звездам и супермоделям выглядеть шикарно и уверенно в любой ситуации. Если вы увлекаетесь новинками и обожаете экспериментировать с макияжем и образами, тогда вам определенно следует пополнить косметичку базой для макияжа.

Праймер поможет добиться идеально ровной кожи и в то же время отрегулирует выделение кожного жира.

Даже если вы думаете, что одной основы достаточно, предварительно нанесенный тонкий слой праймера сотворит с кожей настоящее чудо. Средство заполнит все морщинки и поры, выровняет текстуру кожи, сделает макияж более стойким и улучшит цвет лица.

Шаг 1

Самое главное правило успешного макияжа – это правильное питание кожи. Если нанести макияж на сухую кожу – результат может оказаться плачевным. Подберите увлажняющий крем с легкой текстурой, которая не повлияет на состав праймера. Летом увлажняющее средство должно также содержать и SPF фильтры. Оставьте на минутку. Убедитесь, что увлажняющее средство хорошо впиталось, и при необходимости удалите остатки салфеткой.

Шаг 2

Подберите прозрачный или матирующий праймер. Если вы остановили свой выбор на матирующем, то тон должен максимально соответствовать оттенку вашей кожи. Существует специальный зеленый праймер, который предназначен для маскировки покраснений. Нанесите немного праймера на внешнюю часть ладони, чтобы средство немного нагрелось, возьмите влажный спонж и мягкими втирающими движениями распределите средство по коже. Начинайте с области под глазами, затем переходите к носу, лбу, щекам и подбородку.

Шаг 3

После того, как нанесете праймер на все участки, убедитесь, что хорошо растушевали средство. При необходимости можете добавить еще немного базы на проблемные участки, например, чтобы скрыть морщинки вокруг рта и глаз. Уделите внимание Т-зоне: излишний кожный жир может испортить макияж в течение дня. На проблемные зоны и участки наносите средство при помощи кончиков пальцев, распределяя его легкими вбивающими движениями.

Шаг 4

После нанесения праймера подождите несколько минут, пока средство хорошо впитается и «ляжет» на кожу. Следующий шаг – нанесение основы. Если вы пользуетесь базой, то можете смело пропустить этот этап и просто припудрить кожу.

Шаг 5

Для кожи век используйте праймер, специально разработанный для этой деликатной зоны. Если хотите, чтобы макияж глаз продержался в течение всего дня, нанесите праймер на верхнее и нижнее веко, а затем переходите к нанесению теней. Праймер заставит по-новому заиграть оттенки ваших любимых теней и сделает макияж глаз сияющим и безупречным.

На заметку:

— Увлажняющее средство с жирной текстурой может стать причиной «поплывшего» макияжа. Поэтому так важно подобрать средство с легкой текстурой.

— Если у вас нет времени на ежедневный тщательный макияж, то можете обработать праймером только проблемные зоны и покраснения, а сверху припудрить прозрачной пудрой.

— Праймер великолепно справится с краснотой и шрамами, которые сложно замаскировать одной основой.

— Косметические средства, например, румяна, тени, нанесенные поверх праймера, имеют более ровные и насыщенные оттенки.

Праймер – секретное оружие каждой женщины, которая хочет получить свежую, ровную, матовую основу под любой макияж. Праймер гарантирует гладкий, ровный тон кожи, не забивает поры и не оставляет ощущения тяжести и стянутости. Средство скроет недостатки кожи, обеспечит увлажнение на весь день и создаст идеально ровную основу для нанесения макияжа.

Источник: womentopics.ru

 

Buduaar.ru

Что такое Праймер и как им пользоваться. — Mary Kay (Мэри Кей) для консультантов

 

Что такое праймер и как им пользоваться?

Праймер – это база под макияж. Использование праймерасделает макияж более устойчивым, выровняет цвет лица, скроет неровности ипридаст коже здоровый вид и сияние.

Использование праймера кардинально изменит ваше представлениео макияже. Тональное средство, нанесенное поверх базы, смотрится аккуратнее идержится весь день. Вы можете забыть, что такое «поплывший» макияж.

Это чудо-средство предназначено для того, чтобы создатьгладкую и ровную базу для привычного макияжа и подготовить кожу к нанесениюосновы. База для макияжа относительно новая продукция на косметическом рынке.Ее можно назвать одним из секретов красоты, которые помогают звездам исупермоделям выглядеть шикарно и уверенно в любой ситуации. Если вы увлекаетесьновинками и обожаете экспериментировать с макияжем и образами, тогда вамопределенно следует пополнить косметичку базой для макияжа.

Праймер поможет добиться идеально ровной кожи и в то жевремя отрегулирует выделение кожного жира. Даже если вы думаете, что однойосновы достаточно, предварительно нанесенный тонкий слой праймера сотворит скожей настоящее чудо. Средство заполнит все морщинки и поры, выровняет текстурукожи, сделает макияж более стойким и улучшит цвет лица.

Шаг 1

Самое главное правило успешного макияжа – это правильноепитание кожи. Если нанести макияж на сухую кожу – результат может оказатьсяплачевным. Подберите увлажняющий крем с легкой

текстурой, которая не повлияет на состав праймера. Летомувлажняющее средство должно также содержать и SPF фильтры. Оставьте на минутку.Убедитесь, что увлажняющее средство хорошо впиталось, и при необходимостиудалите остатки салфеткой.

Шаг 2

Подберите прозрачный или матирующий праймер. Если выостановили свой выбор на матирующем, то тон должен максимально соответствоватьоттенку вашей кожи. Существует специальный зеленый праймер, которыйпредназначен для маскировки покраснений.

Нанесите немного праймера на внешнюючасть ладони, чтобы средство немного нагрелось, возьмите влажный спонж и мягкимивтирающими движениями распределите средство по коже. Начинайте с области подглазами, затем переходите к носу, лбу, щекам и подбородку.

Шаг 3

После того, как нанесете праймер на все участки, убедитесь,что хорошо растушевали средство. При необходимости можете добавить еще немногобазы на проблемные участки, например, чтобы скрыть морщинки вокруг рта и глаз.Уделите внимание Т-зоне: излишний кожный жир может испортить макияж в течениедня. На проблемные зоны и участки наносите средство при помощи кончиковпальцев, распределяя его легкими вбивающими движениями.

Шаг 4

После нанесения праймера подождите несколько минут, покасредство хорошо впитается и «ляжет» на кожу. Следующий шаг – нанесение основы.Если вы пользуетесь основой или  можете простоприпудрить кожу минеральной рассыпной пудрой.

Шаг 5

Для кожи век используйте праймер, специально разработанныйдля этой деликатной зоны. Если хотите, чтобы макияж глаз продержался в течениевсего дня, нанесите праймер на верхнее и нижнее веко, а затем переходите кнанесению теней. Праймер заставит по-новому заиграть оттенки ваших любимыхтеней и сделает макияж глаз сияющим и безупречным.

На заметку:

— Увлажняющее средство с жирной текстурой может статьпричиной «поплывшего» макияжа. Поэтому так важно подобрать средство с легкойтекстурой.

— Если у вас нет времени на ежедневный тщательный макияж, томожете обработать праймером только проблемные зоны и покраснения, а сверхуприпудрить прозрачной пудрой.

— Праймер великолепно справится с краснотой и шрамами, которыесложно замаскировать одной основой.

— Косметические средства, например, румяна, тени, нанесенныеповерх праймера, имеют более ровные и насыщенные оттенки.

Праймер – секретное оружие каждой женщины, которая хочетполучить свежую, ровную, матовую основу под любой макияж. Праймер гарантируетгладкий, ровный тон кожи, не забивает поры и не оставляет ощущения тяжести истянутости.

Средство скроет недостатки кожи, обеспечит увлажнение на весь деньи создаст идеально ровную основу для нанесения макияжа.

Primer — ЗАЧЕМ? Вот как-то не довелось мне до минеральнойкосметике услышать о праймере, а очень жаль!

Любой праймер предназначен для визуального минимизирования пор,скрытия линий тонких морщинок, матирования. Его основная задача — подготовитькожу к минералам, в нем есть компоненты, которые улучшают сцепление основы скожей и компоненты, которые улучшают скольжение — то есть основа наносится ещеболее тонким слоем и потому выглядит еще естественнее.

Средство-основа под макияж не регулирует выделение кожного жира, а тольковпитывает. Впитал в 7 раз больше своего веса — и все. Поэтому важно наноситьего кистью для тональной основы, он тогда заходит достаточно плотно в кожу и насамом деле служит барьером кожному жиру и предохраняет макияж.

Пожалуйста, не забывайте, что primer не устраняет причину, атолько помогает избавиться от неэстетичных проявлений выработки кожного сала. Если вам нужно нормализовать работу сальных желез — то вам нужны продукты,которые которые борются с самой причиной появления жирного блеска — это кремы,скрабы, маски, лосьоны, тоники.

На весь день иногда матирования не хватает (у меня оченьжирная кожа, и у нас все-таки жарко). Но реально помогает. Я крашусь утромчасов в 6, а матирующую салфетку использую уже после обеда, часа в 3.

Я иногда, когда перехожу на новый дневной крем, могусказать, что этот крем более жирный, чем тот, что был до него — именно постепени работы Oil-Control, справляется — не справляется. Но с праймеромгораздо лучше.

У МЕНЯ НЕ ЖИРНАЯ КОЖА, НУЖЕН ЛИ МНЕ ПРАЙМЕР?

Нет никакой связи с жирностью кожи! — Праймер предназначенпрежде всего для того, чтобы подготовить вашу кожу к нанесению основы, чтобыона легла еще более тонким слоем (и потому выглядела еще более натурально), ибыло лучше сцепление с кожей (значит, основа будет лучше держаться на коже).Праймер расходуется чрезвычайно медленно (если вы используете кисть длятональной основы (таклоновую кисть), а без этой кисти это просто переводпродукта), и основа с праймером расходуется меньше.

Таклон- это синтетическое волокно максимально приближено к натуральномуволосу. Кисти из таклона — не только не уступают по своих характеристикам, но ипревосходят их. Цена настоящих кистей из ТАКЛОНА практически не уступаетнатуральным кистям. Многие продавцы продают ТАКЛОН за соболя или белку — аразличить их действительно бывает сложно, если только поджечь ворсинку (приподжигании ТАКЛОНА — происходит плавление волоса и не выделяется специфическогозапаха, как при горении натурального.)

У  ТАКЛОНА есть ряд неоспоримых преимуществперед натуральными кистями:

1. Их можно мыть хоть после каждого использования (что оченьважно для профессиональных визажистов)

2. Они не могут вызвать аллергии (если у человека естьсклонность к аллергии от шерсти, волос  ит.д. – советуем  пользоватьсяисключительно ТАКЛОНОВЫМИ кистями)

3. У таклона есть такое свойство — как не брать излишеккосметики — т.е.с читается, что с использованием ТАКЛОНОЙ КИСТИ- уменьшаетсярасход  косметики.

4. Они  гораздо дольшесохраняют форму.

5. Самые идеальные таклоновые кисти это для губ и глаз — онинастолько шелковистые и при этом менее сгибаемые,  чем натуральные — что пользоваться ими одноудовольствие.

Но в любом случаеВыбор за Вами — многие никогда не изменят проверенным НАТУРАЛЬНЫМ, а некоторыеуже успели полюбить новые кисти из нового материала.

Понравился материал «Что такое Праймер и как им пользоваться.» — расскажи друзьям и оставь свой комментарий без регистрации.

Что такое праймер и как им правильно пользоваться? — 1000 секретов

Праймер – это база под макияж. Использование праймера сделает макияж более устойчивым, выровняет цвет лица, скроет неровности и придаст коже здоровый вид и сияние.

Использование праймера кардинально изменит ваше представление о макияже. Тональное средство, нанесенное поверх базы, смотрится аккуратнее и держится весь день. Вы можете забыть, что такое «поплывший» макияж.

Праймер – это незаменимая вещь, которая должна быть у каждой женщины. Это чудо-средство предназначено для того, чтобы создать гладкую и ровную базу для привычного макияжа и подготовить кожу к нанесению основы. Он имеет разную консистенцию: жидкую и кремообразную. Легко ложится на лицо и выравнивает его текстуру. Благодаря этому чудо-средству можно скрыть многие косметические недостатки, которые обычная тональная основа замаскировать не может. Это прыщи, и угри, и различные покраснения, и даже шрамы, которые остались после лечения акне.

База для макияжа относительно новая продукция на косметическом рынке. Ее можно назвать одним из секретов красоты, которые помогают звездам и супермоделям выглядеть шикарно и уверенно в любой ситуации. Если вы увлекаетесь новинками и обожаете экспериментировать с макияжем и образами, тогда вам определенно следует пополнить косметичку базой для макияжа.

Праймер поможет добиться идеально ровной кожи и в то же время отрегулирует выделение кожного жира. Даже если вы думаете, что одной основы достаточно, предварительно нанесенный тонкий слой праймера сотворит с кожей настоящее чудо. Средство заполнит все морщинки и поры, выровняет текстуру кожи, сделает макияж более стойким и улучшит цвет лица.

Как выбрать праймер?

Выбирать праймер следует очень тщательно, учитывая особенности вашей кожи. По своему составу праймеры подразделяются на:

  • светоотражающий;
  • силиконовый;
  • минеральный.

Светоотражающие праймеры имеют в своем составе светоотражающие частицы, которые, улавливая электрическое освещение, «заставляют» кожу лица сиять. Как правило, их используют для вечернего макияжа. Они бывают как холодных оттенков, так и теплых. Холодные оттенки подходят для светлой кожи, а теплые – для более темной. Наносятся светоотражающие праймеры на все лицо.

Силиконовые праймеры благодаря своей структуре заполняют все поры, за счет чего кожа приобретает гладкую, ровную и бархатную поверхность. Идеально подходят для нормальной и жирной кожи. Наносятся как на все лицо, так и локально.

Минеральные праймеры имеют зеленый оттенок, благодаря чему скрывают все покраснения на лице. Отлично подходит для проблемной кожи. Наносятся они точечно, только на те зоны, которые имеют красный цвет (прыщи, угри, раздражения и т. д.).
По своему назначению праймеры бывают:

  • для век;
  • для губ;
  • для ресниц;
  • для лица (тонирующий, увлажняющий, матирующий).

Все праймеры обладают солнцезащитными свойствами, они защищают кожу лица от прямого воздействия солнечных лучей, тем самым предотвращая ее преждевременное старение. Кроме того, в их составе также присутствуют различные витамины и антиоксиданты, которые способствуют омоложению кожи, делая ее более упругой и подтянутой.

При выборе обязательно учитывать тип вашей кожи лица. Дело в том, что если у вас жирная кожа и вы приобретете праймер, который имеет жидкую консистенцию, то макияж, наносящийся сверху, будет «расплываться» и выглядеть неаккуратно. Поэтому для данного типа кожи рекомендуется приобретать праймеры кремообразной консистенции или же пудинг-праймер, который только недавно появился в продаже на наших рынках. Он имеет текстуру обычной пудры, легко ложится и также маскирует все косметические недостатки. Кроме того, благодаря его структуре жирная кожа лица немного «присушится», исчезнет жирный блеск, а макияж ляжет ровно и будет выглядеть идеально.

Как пользоваться праймером для лица

Шаг 1. Самое главное правило успешного макияжа – это правильное питание кожи. Если нанести макияж на сухую кожу – результат может оказаться плачевным. Подберите увлажняющий крем с легкой текстурой, которая не повлияет на состав праймера. Летом увлажняющее средство должно также содержать и SPF фильтры. Оставьте на минутку. Убедитесь, что увлажняющее средство хорошо впиталось, и при необходимости удалите остатки салфеткой.

Шаг 2. Подберите прозрачный или матирующий праймер. Если вы остановили свой выбор на матирующем, то тон должен максимально соответствовать оттенку вашей кожи. Существует специальный зеленый праймер, который предназначен для маскировки покраснений. Нанесите немного праймера на внешнюю часть ладони, чтобы средство немного нагрелось, возьмите влажный спонж и мягкими втирающими движениями распределите средство по коже. Начинайте с области под глазами, затем переходите к носу, лбу, щекам и подбородку.

Шаг 3. После того, как нанесете праймер на все участки, убедитесь, что хорошо растушевали средство. При необходимости можете добавить еще немного базы на проблемные участки, например, чтобы скрыть морщинки вокруг рта и глаз. Уделите внимание Т-зоне: излишний кожный жир может испортить макияж в течение дня. На проблемные зоны и участки наносите средство при помощи кончиков пальцев, распределяя его легкими вбивающими движениями.

Шаг 4. После нанесения праймера подождите несколько минут, пока средство хорошо впитается и «ляжет» на кожу. Следующий шаг – нанесение основы. Если вы пользуетесь базой, то можете смело пропустить этот этап и просто припудрить кожу.

Шаг 5. Для кожи век используйте праймер, специально разработанный для этой деликатной зоны. Если хотите, чтобы макияж глаз продержался в течение всего дня, нанесите праймер на верхнее и нижнее веко, а затем переходите к нанесению теней. Праймер заставит по-новому заиграть оттенки ваших любимых теней и сделает макияж глаз сияющим и безупречным.

На заметку:

  • Увлажняющее средство с жирной текстурой может стать причиной «поплывшего» макияжа. Поэтому так важно подобрать средство с легкой текстурой.
  • Если у вас нет времени на ежедневный тщательный макияж, то можете обработать праймером только проблемные зоны и покраснения, а сверху припудрить прозрачной пудрой.
  • Косметические средства, например, румяна, тени, нанесенные поверх праймера, имеют более ровные и насыщенные оттенки.

Праймер – секретное оружие каждой женщины, которая хочет получить свежую, ровную, матовую основу под любой макияж.

Праймер 3М 94, для чего нужен и как пользоваться

Как использовать праймер 3M 94 и как им пользоваться?

 

Этот продукт, не имеет достойных аналогов у других производителей, был создан компанией 3М, которая является мировым лидером по изготовлению различных авто аксессуаров, химии и пр.

Его основное предназначение – это усиление клеевого эффекта авто пленок, самоклеющихся пленок, скотчей и др.

Праймер 3M 94 – незаменимый помощник при оклейке автомобиля виниловыми пленками, он значительно усиливает адгезию, выступает в роли специального клея. 3m праймер не разъедает пленку и лакокрасочное покрытие авто, как это может делать другой, не специальный клей.

Для чего нужен Primer 3M 94?

Все виниловые пленки для стайлинга авто на самоклеющейся основе, но на сложных участках, на поворотах, на тех деталях, на которых пленка значительно растягивается — опытные оклейщики используют праймер 3м 94.

Дело в том, что в тех местах (выпуклостях, впадинах, на объемных деталях), где пленка подвергается сильному растяжению её клеевой слой тоже тянется и, соответственно,  истончается, клея становится значительно меньше, вот здесь и нужно надо помочь пленке удержаться на поверхности. В этих случаях праймер 3М становится незаменимым помощником.

Как использовать праймером?

Необходимо предварительно промазать оклеиваемую область поверхность primer 3m 94, для того, что бы на краях деталей пленка не отклеивалась, а в углублениях – не вздувалась.

Через 5 минут на эту поверхность уже можно клеить пленку без опасений.

В случае, если вы не воспользовались изначально праймером и  пленка отклеилась, нужно аккуратно отогнуть край пленки, протереть область под пленкой, лучше универсальным мягким обезжиривателем (для этого прекрасно подойдет изопропиловый спирт), после чего нанести праймер, и через 5 минут приклеить  пленку обратно. Но имейте ввиду, если на клеевой слой пленки успела прилипнуть пыль и грязь, то спасать ситуацию уже поздно.

 

Купить праймер 3М 94 из Харькова недорого. Мы расфасовываем праймер в удобные небольшие емкости объемом 25, 50 и 100 мл, так как он используется очень экономно, и большую банку часто покупать не имеет смысла.

Праймеры для волос

Праймеры для волос не так давно появились на рынке, но даже за такое короткое время успели понравиться как профессионалам бьюти-индустрии, так и простым покупателям. Так что же такое hair-праймеры, и за что их любят?

 

Это стайлинг

Главная цель праймеров — максимально подготовить волосы к дальнейшей укладке. Они грунтуют поверхность, как бы разглаживая ее, заполняя пустоты для идеальной гладкости полотна. Конечно, такая подготовка значительно облегчает процесс создания прически.

Помимо этого,  стайлинг обладает влагоотталкивающим действием. Например, с праймером Rare Oil Extending Primer гладкая укладка выдержит любые капризы осенней погоды без пушистости и спутанности.

 

А еще огромный плюс для обладателей тонких волос — невесомая текстура. Этот праймер Rare Oil Extending Primer в виде спрея не утяжеляет, его без опаски можно наносить по всей длине.

Отдельный бонус – это шикарный блеск! К слову, Awapuhi Mirrorsmooth High Gloss Primer создает настолько ровную поверхность, что волосы блестят как никогда.

Кстати, все праймеры можно использовать как самостоятельный продукт и не использовать после него дополнительное укладочное средство.

Это дополнительный уход

Все праймеры Paul Mitchell содержат ухаживающие компоненты, но Rare Oil Extending Primer на этом фоне выгодно отличается. Ведь он обогащен ценным маслом марулы с рекордным количеством аминокислот и питательных элементов.

Что касается Awapuhi Mirrorsmooth High Gloss Primer, то благодаря абиссинскому маслу, кератиновым протеинам и экстракту авапуи волосы дополнительно увлажнены и напитаны полезными веществами. Фаворит длинных волос, идеальное средство на каждый день и для фотосессий.

 

Это защита

А именно — защита от вредного воздействия высоких температур при укладке на стайлеры и даже при сушке феном. Как известно, без должной заботы при термоукладке влага активно испаряется и наступает обезвоживание в сопровождении ломкости, секущихся кончиков и других неприятностей.

Поэтому в компании Paul Mitchell придумали средство Neuro Prime HeatCTRL Blowout Primer с максимальной степенью термозащиты. Продукт выполняет все функции праймера (грунтовка волоса, выравнивание), но также и предотвращает излишнюю потерю влаги при укладке. И это очень удобно для тех, кто не мыслит ни дня без стайлеров.

 

По такому же принципу работает и Awapuhi Mirrorsmooth High Gloss Primer — он также обладает мощным защитным фактором и оберегает здоровье локонов во время горячих укладок. Нюанс — если наносить его на сухие волосы (как финиш), то блеска и характерной текстуры будет больше.

Да, прогрессивный стайлинг с функцией термозащиты это очень выгодная покупка, ведь им можно спокойно заменить свое привычное термозащитное средство.

Вернуться к списку публикаций

Битумные праймеры виды и применение

Битумные праймеры

             Праймер битумный – это черная однородная жидкость, являющаяся раствором нефтяных битумов (температура их размягчения не меньше 80 градусов по Цельсию) в органических растворителях (также праймер называют: битумная грунтовка). В составе материала нет посторонних включений или неоднородностей. Он не содержит токсичных растворителей, таких как толуол.

Праймер значительно облегчает проведение гидроизоляционных и кровельных работ. Он позволяет сократить время производства работ и улучшить качество гидроизоляции.

Виды. Битумный праймер бывает двух видов: готовый к применению и концентрированный. Перед применением концентрированный праймер (концентрат) нужно развести одним из органических растворителей  (керосин, уайт-спирит, бензин) 1:1,5 или 1:2. Это позволяет экономить на его использовании, при перевозке и хранении. С готовым материалом не нужно проводить никаких предварительных процедур, кроме тщательного перемешивания. Он полностью готов к применению. Такой праймер очень удобен в работе. Отсутствие необходимости в приготовлении праймера из концентрата значительно повышает скорость производства работ.

Применение. Битумный праймер используется для грунтования поверхности  (бетон, железобетон, металл, асбоцемент, дерево, пористые материалы) при гидроизоляционных и кровельных работах. При этом он может применяться как самостоятельный гидроизолирующий продукт, так и в комплексе с другими наплавляемыми и самоклеющимися кровельными материалами.

В частности, битумный праймер используется для подготовки к гидроизоляционным работам:

·         Оснований плоских кровель,

·         Фундаментов,

·         Подземных конструкций и сооружений,

·         Мостовых пролетов,

·         Поверхности металлических трубопроводов.

Продукт широко используется для защиты металлов от коррозии.

Наносить праймер можно на бетонные, цементно-песчаные и другие шероховатые поверхности. Пыльная, пористая, неровная поверхность обрабатывается битумным праймером с помощью капроновых кистей или щеток. Такой способ нанесения гарантирует хорошую пропитку основы праймером, а также высокую адгезию с гидроизолирующими материалами. Грунтование поверхностей битумным праймером позволит значительно продлить срок эксплуатации материалов для гидроизоляции.

Для наклеивания рулонных материалов с помощью праймера поверхность бетонных, железобетонных плит, а также швов между отдельными элементами грунтуется полностью. Каждый последующий слой рулонного материала можно приклеивать только через три-четыре часа после наклеивания предыдущего. Рулонные материалы приклеиваются внахлест (не менее 100 мм), при этом избегают перекрестного наклеивания. Приклеенное полотно хорошо прикатывается специальным цилиндрическим катком.

Качественные характеристики. Битумный праймер обладает рядом отличных эксплуатационных качеств:

·         Высокая адгезия,

·         Быстрое высыхание,

·         Отсутствие липкости,

·         Гидроизолирующие качества,

·         Теплостойкость,

·         Препятствует процессам коррозии,

·         Используется в качестве клеящей мастики для наклеивания рулонных материалов,

·         Может применяться в зимнее время,

·         Обладает водовытесняющими свойствами.

Битумные праймеры обеспечивает высокую адгезию основы с гидроизоляционным материалом. При средней температуре в 20 градусов тепла, поверхность, обработанная битумным праймером, высыхает за 12 часов.

При необходимости продукт может применяться в зимнее время, при условии полной очистки рабочей поверхности от снега, льда, грязи и непрочных элементов предыдущего покрытия. Перед работой ее необходимо высушить, а сами рулонные материалы отогреть в теплом помещении с температурой воздуха не менее 15 градусов по Цельсию на протяжении суток. Работы по устройству рулонных кровель с применением битумного праймера могут проводиться, только если наружная температура воздуха составляет не ниже -20 градусов.

Условия работы и особенности хранения. При производстве работ с применением битумного праймера необходимо обеспечить хорошую вентиляцию помещения или работать на свежем воздухе. Материал пригоден к работе, если его температура выше 10 градусов по Цельсию. При необходимости рабочую поверхность и сам праймер можно немного разогреть. При этом праймер нельзя нагревать выше 40 градусов, а также выполнять грунтование поверхности вблизи открытого огня. При работе с праймером нужно пользоваться защитной одеждой и очками, чтобы не допустить попадания материала на кожу и в глаза.

Срок хранения составляет 12 месяцев при температуре воздуха от -20 до +30 градусов по Цельсию. Хранить праймер нужно в сухом месте, защищенном от прямых солнечных лучей.

Компания ХимТоргПроект предлагает вашему вниманию битумные праймеры высокого качества (концентраты и готовые к применению).

Купить в Петровиче

что это такое, какой бывает, где применяется, как выбрать

Давайте подробнее поговорим о том, что из себя представляет битумный праймер, где он используется и зачем вообще нужен.

Что такое битумный праймер

Для начала немного теории:

Праймер – это холодная битумная грунтовка. Название происходит от английского priming – которое, кстати, так и переводится, «грунтование». 

Холодной грунтовку называют потому, что она не требует обязательного разогрева, подготовки или каких-либо других приготовлений. То есть, поставляется уже в полностью пригодном для работы виде. Хотя, бывают и исключения – например «Праймер-концентрат», но это довольно редкие случаи и чаще оказывается удобнее использовать уже готовый продукт, а не разводить до нужной (на ваш взгляд) консистенции.

Обратимся к википедии:

«Грунтовка – состав, наносимый первым слоем на подготовленную к окраске или отделке поверхность для создания надежного сцепления верхних (кроющих слоев) покрытия с обрабатываемой поверхностью, и выравнивания ее впитывающей способности».

Итак, мы определились с основными понятиями и выяснили что такое битумный праймер – холодная битумная грунтовка. А также узнали что такое грунтовка и зачем она в принципе нужна. Перейдем теперь от общих моментов к частностям.

Для чего используется битумный праймер

Чаще всего праймер применяется при устройстве кровельного или гидроизоляционного ковра именно в качестве грунтовки для основания. То есть, им покрывают стяжку или другую поверхность (например, фундамент) перед наплавлением битумных рулонных материалов.

Итак, зачем же нужно обрабатывать праймером поверхность?

Грунтование стяжки праймером обеспечивает не только обеспыливание поверхности, но и существенно увеличивает адгезию рулонных материалов к основанию (битум-к-битуму). Более того, битумный праймер выравнивает поверхность стяжки, проникая в микропоры и трещины, не заметные невооруженным глазом. Тем самым обеспечивая более надежную гидроизоляцию основания.

Улучшение адгезии и дополнительный, хоть и небольшой, слой гидроизоляции, создаваемый праймером, значительно увеличивают срок службы кровельного или гидроизоляционного пирога. К тому же снижает вероятность протечек.

Подводя итог этой небольшой, но информативной статьи, хочется отметить, что мы ни коим образом не настаиваем на применении праймера при устройстве кровли (в отличие от технологии производства работ).

Однако, хотим напомнить, что мы не только производим хорошую и недорогую битумную грунтовку, но и сопровождаем каждое ведро нашего праймера – любовью и заботой.

Всегда в наличии на нашем складе несколько видов битумных праймеров, на любой вкус и кошелек. А наши менеджеры помогут сделать самый оптимальный выбор исходя из ваших потребностей.

Звоните и заказывайте праймеры в компании Ант-Снаб!

Что такое грунтовка для дерева? — Лучшая грунтовка для дерева

Амазонка

Праймер KILZ Premium Primer

Masterchem Industries amazon.com

20,99 долл. США

Если вы собираетесь начать свой собственный проект DIY, покрасив что-нибудь деревянное, остановитесь прямо здесь — вы захотите использовать грунтовку для дерева, и вот почему: это сделает вашу покраску намного более гладкой, чем если бы вы этого не делали. используйте один, это придаст ему более профессиональный вид, защитит дерево и улучшит качество краски.Итак, что именно нужно знать о грунтовке для дерева перед ее покупкой? Вот основная информация.

Что такое грунтовка для дерева?

Грунтовка для дерева — это грунтовка подготовительного покрытия, наносимого на древесину, а именно перед нанесением на нее краски. Использование грунтовки для дерева увеличивает долговечность лакокрасочного покрытия, обеспечивает лучшую адгезию краски к поверхности и помогает защитить окрашиваемую древесину.

Когда следует использовать грунтовку для дерева?

Все зависит от породы дерева, которую вы будете красить.Согласно Lowe’s, когда вы красите новую древесину, которая не окрашена, вы должны использовать высококачественную латексную грунтовку или грунтовку на масляной основе. Если ваша новая древесина окрашена или окрашена, вам понадобится грунтовка, препятствующая образованию пятен. Для более старой, более состаренной древесины требуется высококачественная латексная или масляная грунтовка.

Как использовать грунтовку для дерева?

Сначала необходимо тщательно очистить дерево, которое вы будете красить, а затем отшлифовать поверхность. После шлифовки удалите всю пыль, скопившуюся во время процесса.(Вымойте поверхность влажной тряпкой, чтобы убедиться, что на ней нет частиц.) Затем нанесите грунтовку для дерева. Вы должны нанести два слоя грунтовки, которая в конечном итоге станет немного меловой.

Полуглянцевая краска

BEHR homedepot.com

35,98 $

Набор малярных валиков

Выбор Бейтса amazon.com

15 долларов.99

Этот контент импортирован из {embed-name}. Вы можете найти тот же контент в другом формате или найти дополнительную информацию на их веб-сайте.

Следуйте за House Beautiful в Instagram.

Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты.Вы можете найти больше информации об этом и подобном контенте на сайте piano.io.

Инструмент для создания праймеров

Выбор экзонов / интронов Последовательность мРНК refseq в качестве входных данных шаблона ПЦР требуется для параметров в разделе Справка

Последовательность мРНК refseq (например, запись последовательности entrez, номер которой начинается с NM_) позволяет программе правильно идентифицировать соответствующую геномную ДНК и, таким образом, находить правильные границы экзона / интрона.

Размах соединения экзонов Нет предпочтений Праймер должен охватывать соединение экзон-экзон. Праймер не может охватывать соединение экзон-экзон. Справка

Это контролирует, должен ли праймер охватывать соединение экзона на вашей матрице мРНК. Параметр «Праймер должен охватывать соединение экзон-экзон» предписывает программе возвращать по крайней мере один праймер (в пределах данной пары праймеров), который охватывает соединение экзон-экзон.Это полезно для ограничения амплификации только мРНК. Вы также можете исключить такие праймеры, если хотите амплифицировать мРНК, а также соответствующую геномную ДНК.

Соответствие соединения экзона

Мин. 5 минут матча Мин. 3 ‘матча Максимум 3 минуты матча

Минимальное и максимальное количество оснований, которые должны отжигаться с экзонами на 5 ‘или 3’ стороне соединения Справка

Это определяет минимальное количество оснований, которое праймер должен отжигать с шаблоном со стороны 5 футов (т.е.е., к началу праймера) или 3′-стороне (т.е. к концу праймера) соединения экзон-экзон. Отжиг к обоим экзонам необходим, поскольку он обеспечивает отжиг к области перехода экзон-экзон, но не к каждому экзону в отдельности. Обратите внимание, что этот параметр эффективен только в том случае, если вы выбрали «Праймер должен охватывать соединение экзон-экзон» для параметра «Диапазон соединения экзона».

Включение интрона Диапазон длины интрона Параметры проверки специфичности пары праймеров Проверка специфичности Режим поиска Автоматически Управляется пользователем Нет руководства пользователя Справка

Primer-blast пытается найти специфичные для мишени праймеры, помещая кандидатные праймеры в уникальные области матрицы, которые не похожи на другие мишени. Однако в некоторых случаях праймер-взрыв не может определить, является ли последовательность базы данных предполагаемой целью или нет, поэтому руководство пользователя может быть полезным (например, когда ваш шаблон представляет собой полиморфную форму или частичную область записи в поиске database, или когда база данных, такая как nr, содержит повторяющиеся записи вашего шаблона).
Параметр «Автоматически» запрашивает руководство пользователя только тогда, когда программа не находит достаточного количества уникальных областей шаблона, в то время как параметр «Управляемый пользователем» всегда запрашивает руководство пользователя, если ваш шаблон показывает большое сходство с любыми другими последовательностями базы данных.

База данных Refseq репрезентативные геномы mRNARefseq Геномы для выбранных организмов (только первичная эталонная сборка) nrRefseq РНК (refseq_rna) Пользовательский Справка

Refseq мРНК:
& nbsp & nbsp & nbsp Это содержит только мРНК из коллекции эталонных последовательностей NCBI

репрезентативных геномов Refseq:
& nbsp & nbsp & nbsp Эта база данных содержит эталонные и репрезентативные геномы NCBI RefSeq по широким группам таксономии, включая эукариоты, бактерии, археи, вирусы и вироиды. Эти геномы являются одними из лучших геномов, доступных в NCBI. Эта база данных содержит минимальную избыточность в представлении генома. Для эукариот включается только один геном для каждого вида (однако, альтернативные локусы эукариотических геномов включены, где это применимо). Для других видов могут быть включены геномы из различных изолятов одного и того же вида. Если применимо, включены геномы митохондрий.

Refseq РНК:
& nbsp & nbsp & nbsp Это содержит все записи РНК из коллекции эталонных последовательностей NCBI

Геномы для выбранных организмов (только первичная эталонная сборка):
& nbsp & nbsp & nbsp Это полные или почти полные последовательности генома из первичных хромосомных сборок (т.е., без митохондрий или альтернативных локусов) для следующих выбранных организмов:

& NBSP & NBSP & nbspapis MELLIFERA
& NBSP & NBSP & nbspbos Taurus
& NBSP & NBSP & nbspdanio rerio
& NBSP & NBSP & nbspdog
& NBSP & NBSP & nbspdrosophila MELANOGASTER
& NBSP & NBSP & nbspgallus Gallus
& NBSP & NBSP & nbsphuman
& NBSP & NBSP & nbspmouse
& NBSP & NBSP & nbsppan троглодиты
& NBSP & NBSP & nbsppig
& NBSP & NBSP & nbsprat

Хотя последовательности в этой базе данных полностью покрыты базы данных представительные геномов RefSeq, он не содержит альтернативных локусов и, следовательно, имеет даже меньшую избыточность, чем репрезентативная база данных геномов Refseq. Эта база данных рекомендуется, если вас не беспокоит отсутствие альтернативных локусов или последовательностей митохондрий.

Пользовательский:
& nbsp & nbsp & nbspВы можете использовать свои собственные последовательности (инвентарный номер, gi или последовательность FASTA) в качестве базы данных поиска. Размер базы данных ограничен 300 МБ.

Строгость специфичности праймера Грунтовка должна иметь не менее 123456 всего несовпадений по непреднамеренным целям, в том числе
по меньшей мере 123456 несоответствия в пределах последнего 1 2 3456 78910111213141516171819202122 бит / с на 3 ‘конце. Справка

Для этого требуется, чтобы по крайней мере один праймер (для данной пары праймеров) имел заданное количество несовпадений с непреднамеренными целями. Чем больше несоответствие (особенно в сторону 3 ‘конца) между праймерами и непредусмотренными целями, тем более специфична пара праймеров для вашего шаблона (т.е. будет труднее отжигать с непредусмотренными целями). Однако указание большего значения несовпадения может затруднить поиск таких конкретных праймеров.В таком случае попробуйте уменьшить значение рассогласования.


Игнорировать цели, у которых есть 123456789 или более не соответствует грунтовке. Справка

Это еще один параметр, который можно использовать для регулировки строгости специфичности праймера. Если общее количество несовпадений между мишенью и по крайней мере одним праймером (для данной пары праймеров) равно или больше указанного числа (независимо от местоположений несоответствия), то любые такие мишени будут игнорироваться для проверки специфичности праймера.Например, если вас интересуют только цели, которые идеально соответствуют праймерам, вы можете установить значение 1. Вы также можете уменьшить значение E (см. Дополнительные параметры) в таком случае, чтобы ускорить поиск, как высокое значение E по умолчанию. не требуется для обнаружения мишеней с небольшим количеством несовпадений с праймерами.
Кроме того, эта программа имеет предельное обнаружение мишеней, которые слишком отличаются от праймеров … она обнаруживает мишени, которые имеют до 35% несовпадений с последовательностями праймеров (то есть всего 7 несовпадений для 20-мерного).
Вам может потребоваться выбрать более чувствительные параметры взрыва (в дополнительных параметрах), если вы хотите обнаруживать цели с большим количеством несовпадений, чем по умолчанию.


Максимальный размер целевого ампликона Разрешить варианты стыковки

Primer-BLAST: инструмент для разработки целевых праймеров для полимеразной цепной реакции | BMC Bioinformatics

Пользовательский интерфейс

Интерфейс состоит из нескольких разделов, где пользователи могут вводить шаблон ПЦР и / или уже существующие праймеры, а также другие настраиваемые пользователем параметры (рис. 1).

Рисунок 1

Веб-интерфейс Primer-BLAST.

Пользователи могут создавать новые пары праймеров, вводя только матрицу ДНК, или они могут создавать один праймер, вводя матрицу плюс другой уже существующий праймер. Primer-BLAST может проверить специфичность уже существующих праймеров с матрицей или без нее. Матрица ПЦР может представлять собой необработанную последовательность ДНК в формате FASTA или регистрацию NCBI. Если возможно, рекомендуется использовать регистр RefSeq, поскольку он несет больше информации о последовательности [15], что позволяет Primer-BLAST лучше идентифицировать матрицу и, таким образом, лучше проверять специфичность праймера.Primer-BLAST также выполняет быструю проверку любой исходной входной последовательности, чтобы определить, является ли она точным совпадением с последовательностью RefSeq, и в этом случае Primer-BLAST будет использовать доступ RefSeq в качестве шаблона. Длина шаблона ограничена 50 000 базами. Для более длинных шаблонов следует использовать диапазон праймера (верхний правый угол рисунка 1), чтобы ограничить длину.

Primer-BLAST также предлагает возможность конструировать праймеры на основе экзон / интронной структуры, чтобы амплификация ПЦР могла быть лучше нацелена на мРНК.Пользователи могут указать, должен ли праймер охватывать соединение экзон / экзон с регулируемым количеством оснований на каждой стороне соединения и должна ли пара праймеров охватывать интрон вместе с возможностью указания размера интрона. Поскольку этот параметр зависит от точной аннотации границ экзона / экзона, требуется присоединение RefSeq (в качестве шаблона ПЦР), поскольку RefSeq представляет собой категорию лучше всего курируемых последовательностей в NCBI.

Доступно несколько вариантов баз данных для проверки специфичности с широким охватом организмов.Они включают базу данных мРНК RefSeq и базу данных генома RefSeq, которые по состоянию на 18 ноября 2011 г. содержат 226 и 7 546 организмов соответственно. Эти базы данных не являются избыточными, поскольку они не содержат одни и те же участки последовательности более одного раза, что позволяет лучше проверять специфичность. Они являются предпочтительными базами данных для разработки новых специфичных для мишени праймеров. Традиционная база данных nr, содержащая повторяющиеся записи, также доступна и в основном рекомендуется для организмов, которые не охвачены другими базами данных, или для записей последовательностей, не охваченных базами данных RefSeq.

Primer-BLAST предлагает гибкие варианты строгости специфичности. Пользователи могут указать количество несовпадений, которые пара праймеров должна иметь с непреднамеренными целями, а также 3’-концевую область, где эти несовпадения должны присутствовать. Кроме того, пользователи могут указать порог рассогласования, выше которого любые цели должны игнорироваться (т. Е. Отфильтровывать цели, имеющие слишком много несовпадений, чтобы беспокоиться о неспецифическом усилении). Настройки специфичности по умолчанию таковы, что по крайней мере один праймер (для данной пары праймеров) должен иметь два или более несовпадения с непреднамеренными целями в последних пяти основаниях на 3 ‘конце, и что любые цели с шестью или более несовпадениями по крайней мере с одним праймер (для данной пары праймеров) следует игнорировать.

Не всегда возможно сгенерировать праймеры, специфичные для мРНК конкретного варианта сплайсинга, когда различие в экзонах недостаточно, чтобы отличить один от остальных. Таким образом, Primer-BLAST предлагает вариант обработки вариантов сплайсинга, который позволяет амплифицировать другие варианты того же гена.

Другие параметры, включая параметры чувствительности поиска BLAST, исключения SNP, свойств праймера и т. Д., Можно найти в разделе «Дополнительные параметры».

Представление результатов

Страница результатов сообщает о специфичности сгенерированных праймеров, графическом обзоре пар праймеров по отношению к матрице ПЦР и некоторых характеристиках, таких как экзоны, а также подробную информацию о каждой паре праймеров.Он покажет только специфичные для мишени праймеры, если они будут обнаружены; в противном случае он сообщит обо всех праймерах. Во всех случаях будут перечислены фактические цели вместе с подробным выравниванием праймеров и мишеней.

В качестве примера, иллюстрирующего функциональность Primer-BLAST, мы конструируем праймеры с использованием мРНК варианта 5 транскрипта человеческого цинкового пальца 419 (ZNF419) (номер доступа в Genbank NM_001098494). Как показано на рисунке 2, согласно отчету NCBI Gene, существует семь вариантов транскрипта для гена ZNF419. При поиске использовались значения по умолчанию, которые требуют, чтобы по крайней мере один праймер (для данной пары праймеров) имел два или более несовпадения с непреднамеренными целями в последних пяти основаниях на 3 ’конце. Проверку специфичности проводили по базе данных мРНК NCBI RefSeq с организмом, ограниченным человеческим организмом, поскольку целью было найти пары праймеров, которые специфичны для этого транскрипта только среди человеческого транскриптома. Чтобы избежать возможной амплификации геномной ДНК, выбран вариант «Праймер должен охватывать соединение экзон-экзон».Как показано на рисунке 3, Primer-BLAST успешно вернул пять специфических пар праймеров, и показано детальное сопоставление между мишенями и праймерами. В процессе поиска Primer-BLAST проверил в общей сложности 355744 совпадения BLAST (см. Легенду на Рисунке 3), которые представляют не только варианты транскриптов этого гена, но также большое количество транскриптов из других генов, которые показывают совпадения в различной степени с кандидатом. грунтовки. Это подчеркивает проблему, если такая же тщательная проверка специфичности праймера должна выполняться вручную.Среднее время поиска для создания новых праймеров с параметрами по умолчанию с использованием шаблона мРНК человека средней длины (2800-3000 оснований) составляет 2,6 минуты.

Рисунок 2

Схематическое выравнивание вариантов транскриптов мРНК из гена ZNF419. Цифры указывают конечные положения экзонов для варианта 5. Красные линии указывают области праймеров, выбранные с помощью Primer-BLAST. Обратите внимание, что несколько транскриптов отличаются на 3 нуклеотида из-за использования немного разных сайтов сплайсинга, даже если они имеют одни и те же экзоны (т.е., вариант 2 в.с. вариант 1, вариант 7 в.с. вариант 6 и вариант 4 против. вариант 3). График адаптирован из отчета NCBI по генам (http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=Retrieve&dopt=full_report&list_uids=79744. Данные по состоянию на 11.02.2011).

Фигура 3

Пример результатов разработки специфичных для мишени праймеров. Обратите внимание, что хотя было возвращено пять пар праймеров (как показано в графическом обзоре), из-за ограничения места на рисунке показаны детали только для первой пары праймеров.Ссылка «Сводка поиска» при нажатии показывает используемые параметры поиска, а также общее количество совпадений BLAST, сгенерированных в процессе поиска (355 744 совпадений для текущего поиска). Цифры в выравнивании указывают начальное и конечное положения праймера и мишени. Точка (.) Указывает идентичность нуклеотидов с последовательностью праймера. Обыск производился 02.11.2011.

Исследование выравнивания варианта транскрипта 5 с другими вариантами показывает, что наличие экзона 2 и отсутствие экзона 4 в сочетании являются единственными признаками, которые отличают его от остальных (рис. 2).Неудивительно, что часть или все прямые праймеры, выбранные Primer-BLAST, расположены в экзоне 2, а все обратные праймеры находятся на стыках между экзоном 3 и 5 (поскольку экзон 4 отсутствует).

Primer-BLAST также можно использовать для проверки специфичности уже существующих праймеров. В качестве примера мы получили праймеры для той же матрицы ПЦР, что и выше (т. Е. МРНК варианта 5 транскрипта ZNF419) из PrimerBank, который депонирует множество предварительно рассчитанных ген-специфических праймеров для обнаружения мРНК [16]. Опять же, были использованы параметры специфичности по умолчанию, и результат представлен на рисунке 4.В результате поиска было получено 11 236 совпадений BLAST из базы данных мРНК RefSeq с организмом, ограниченным человеческим организмом, что еще раз демонстрирует сложность ручного анализа результатов BLAST даже для одной пары праймеров. Эта пара праймеров действительно демонстрирует идеальные совпадения с вариантом 5 транскрипта гена ZNF419, а также с другими вариантами транскрипта того же гена и может генерировать ампликон из 444 оснований. Это согласуется с критериями отбора PrimerBank, согласно которым праймеры специфичны только на уровне гена, а не на уровне транскрипта. Интересно, что обнаруживаются и некоторые другие потенциальные ампликоны. Один из них представляет собой дополнительный ампликон из 780 оснований, присутствующий в предполагаемом транскрипте ZNF419. Другой — это ампликон из 444 оснований из другого гена (т. Е. Белка 773 цинкового пальца человека, номер доступа в Genbank NM_198542.1). Однако существует до 5 несовпадений по крайней мере между одним из праймеров и мишенями, что, вероятно, достаточно для предотвращения интерференции амплификации или неспецифической амплификации. Тем не менее, пользователи могут внимательно изучить этот результат и сделать выводы, основываясь на собственном экспериментальном опыте.

Рисунок 4

Проверка специфичности существующих праймеров. Этот поиск был выполнен путем ввода прямого и обратного праймеров без ввода какого-либо шаблона. Праймеры (прямой праймер: GTAGGACTGCTCAGTTCAAACAT, обратный праймер: ACAGTTACTACACCCGTAAGGC) были получены из PrimerBank (http://pga. mgh.harvard.edu/primerbank/) 11.02.2011 с использованием варианта 5 транскрипта ZNF419 (доступ в GenBank NM_001098494). Хотя результаты показали, что все 7 вариантов транскриптов гена ZNF419 имеют одинаковые ампликоны, на этом рисунке показаны детали только для вариантов 1 и 5 из-за ограниченного пространства.Текущий поиск сгенерировал 11 236 совпадений BLAST (выполнено 11.02.2011).

Сравнение с другими инструментами для разработки праймеров

Primer-BLAST предлагает ряд функций, которые недоступны в других программных инструментах. В таблице 1 дается краткое изложение этих характеристик, многие из которых важны для различных требований к конструкции праймеров и позволяют пользователям изучить детали специфичности праймера. Например, Primer-BLAST — единственный инструмент, который предлагает возможность указывать количество несовпадений, которые должна иметь конкретная пара праймеров с непреднамеренными целями, и настраиваемая 3 ’концевая область, где должно присутствовать определенное количество несовпадений. Этот параметр важен для удовлетворения различных требований пользователей к строгости специфичности праймера, поскольку специфичность праймера обычно оценивается по количеству несоответствий, которые он имеет с непреднамеренными целями (большее количество несоответствий дает большую специфичность), и местоположением таких несоответствий (несоответствия). ближе к 3 ‘концу предлагаю больше конкретики). Primer-BLAST — единственная программа из трех, которая будет размещать праймеры на разных экзонах (т. Е. Перекрывать интрон), чтобы избежать амплификации геномной ДНК, а также единственная программа, позволяющая настраивать количество совпадений нуклеотидов с обеих сторон соединение экзон / экзон.Кроме того, Primer-BLAST представляет подробные сопоставления между найденными праймерами и мишенями.

Таблица 1 Сравнение выбранных функций различных инструментов для проектирования грунтовок

Еще одно преимущество Primer-BLAST — высокая чувствительность обнаружения. Как показано выше, Primer-BLAST по умолчанию способен обнаруживать потенциальные мишени амплификации, которые имеют до 5 несовпадений с праймером. Primer-Blast достигает этого результата за счет использования высокочувствительных параметров BLAST, а также дополнительного алгоритма глобального выравнивания NW для обеспечения полного выравнивания между праймером и его мишенью.Однако есть одно предостережение: алгоритм BLAST [6] требует минимального количества совпадений нуклеотидов (размера слова) между запросом и целью, и любые инструменты, использующие BLAST в качестве алгоритма поиска, подпадают под это ограничение. Следовательно, Primer-BLAST (с параметрами по умолчанию) пропустит любые цели, у которых есть 6 или меньше последовательных совпадений с праймером (поскольку Primer-BLAST использует размер слова 7 по умолчанию). Например, если у цели есть несовпадения с праймером из 20 оснований в положениях 7 и 14 (при условии, что конец 5 ‘находится в позиции один), цель будет пропущена Primer-BLAST (с параметрами по умолчанию), даже если у нее только 2 несоответствия.Предполагая случайное распределение местоположений несовпадений, можно вычислить количество возможных расположений из 18 совпадений и 2 несовпадений. Существует 20 * 19 различных способов разместить 2 несоответствия среди 18 совпадений, но только 2 из них приводят к размеру слова меньше 7, поэтому вероятность пропуска цели с 2 несоответствиями с праймером из 20 оснований равна 2 / (20 * 19) или около 0,5%.

Далее мы сравним чувствительность обнаружения цели между Primer-BLAST и другими инструментами для разработки праймеров, такими как QuantPrime и PRIMEGENS.В идеале сравнение чувствительности обнаружения должно заключаться в непосредственном тестировании модулей проверки специфичности во всех инструментах с использованием праймеров, созданных третьей стороной (например, праймеров, созданных с помощью Primer3). К сожалению, этот вариант недоступен, поскольку Primer-BLAST — единственный инструмент, который предлагает прямую проверку специфичности (то есть проверку специфичности уже существующих праймеров). В качестве альтернативы мы использовали QuantPrime и PRIMEGENS для создания специфичных для мишени праймеров, а затем использовали Primer-BLAST для исследования этих праймеров на предмет потенциальных мишеней.Если Primer-BLAST не находит других целей, кроме предполагаемой (т.е. самой входной матрицы мРНК), то можно сделать вывод, что QuantPrime и PRIMEGENS по крайней мере так же чувствительны, как Primer-BLAST. С другой стороны, наличие непреднамеренных целей, обнаруженных с помощью Primer-BLAST, может указывать на то, что эти инструменты не так чувствительны, как Primer-BLAST, в чувствительности обнаружения целей (поскольку эти инструменты уже исследовали такие цели, но не смогли избежать их во время их выбора. процессы для специфичных для мишени праймеров).

Тестовые шаблоны выбираются случайным образом из базы данных мРНК NCBI Refseq, и они включают 52 человеческие последовательности для тестирования QuantPrime и 24 последовательности Arabidopsis thaliana для тестирования PRIMEGENS (поскольку PRIMEGENS не поддерживает человеческие последовательности). Как показано в таблице 2, QuantPrime или PRIMEGENS сгенерировали пары праймеров для большинства тестовых случаев, которые они сочли специфичными для входных шаблонов. Однако Primer-BLAST выявил, что многие из них (13,4% пар праймеров из QuantPrime и 43,3% пар праймеров из PRIMEGENS) имеют потенциальные непреднамеренные мишени, которые показывают от одного до пяти несовпадений нуклеотидов.В результате большая часть тестовых примеров имеет по крайней мере одну пару праймеров, которая имеет потенциальные непреднамеренные цели (31,5% для QuantPrime и 93,3% для PRIMEGENS). Некоторые мишени имеют только одно или два несовпадения с праймерами, полученными из QuantPrime (18,5%), хотя эта часть намного меньше для PRIMEGENS (3,4%).

Таблица 2 Сводка потенциальных непреднамеренных целей для пар праймеров, о которых сообщили QuantPrime и PRIMEGENES a

На Рисунке 5 показаны детали для 5 потенциальных непреднамеренных целей.Например, QuantPrime генерирует две пары праймеров (пример 1 и 2), которые разработаны, чтобы быть специфичными для доступа Genbank NM_182690.2 и NM_001039567.2, соответственно (рисунок 5). Однако Primer-BLAST показывает, что эти две пары имеют потенциальные непреднамеренные мишени, NM_005227.2 и NM_001008.3, соответственно, которые имеют только одно нуклеотидное несоответствие с прямым или обратным праймерами. Пара праймеров, созданная PRIMEGENS (пример 4), также показывает потенциальную непреднамеренную мишень только с одним несоответствием.Как рассмотрено ранее, несоответствие одного нуклеотида (даже на 3 ’конце) не оказывает значительного влияния на амплификацию мишени, и поэтому эти пары праймеров вряд ли будут специфичными для предполагаемых мишеней. Неспособность обнаружить единственное несоответствие оснований (нуклеотидное основание G в примере 1) или около 3 ’конца (нуклеотидное основание C в примере 2) показывает недостаток использования только алгоритма локального выравнивания. Локальное выравнивание пытается максимизировать результат, который оно возвращает, поэтому оно не будет включать несоответствия в конце или (возможно) ближе к концу выравнивания, поскольку они уменьшили бы общую оценку [6].Другие случаи непреднамеренных мишеней включают 2 несовпадения (пример 3) или 5 несовпадений (пример 5) с одним из праймеров.

Рисунок 5

Примеры потенциальных непреднамеренных мишеней для пар праймеров, созданных QuantPrime и PRIMEGENS. Примеры мишеней извлекаются из результатов проверки специфичности Primer-BLAST для пар праймеров, созданных с помощью QuantPrime или PRIMEGENS (всего было идентифицировано 162 и 116 потенциальных непреднамеренных мишеней для QuantPrime и PRIMEGENS, соответственно.См. Подробности в таблице 2). Примеры праймеров соответствуют тем, которые подчеркнуты в дополнительных файлах 1 и 2.

Таким образом, мы заключаем, что Primer-BLAST способен обнаруживать потенциальные непреднамеренные цели, которые не попадают в поле зрения QuantPrime или PRIMERGENS во время процесса скрининга специфичности.

Как нанести праймер для минимизации пор

3 комментария

Если вы послушаете любого гуру красоты или профессионального визажиста, они скажут вам, что хороший праймер — это быстрый ответ на уменьшение внешнего вида пор, тонких линий и дефектов текстуры, которые могут помешать безупречному цвету лица.

Но влияет ли

на то, как вы наносите этот праймер, на то, насколько хорошо он работает? На мой взгляд, когда дело касается разглаживающих и заполняющих поры грунтовок, ДА.

Я действительно ненавидел праймеры для заполнения пор в течение многих лет, потому что я чувствовал, что они на самом деле ничего не делают, чтобы скрыть мои поры, но после настройки

того, как я наносил эти типы праймеров, я пришел к тому, чтобы изменить это мнение, и теперь, Я ежедневно беру разглаживающие праймеры…

* этот пост содержит партнерские ссылки *

Что такое праймер для макияжа?

Праймер для макияжа — это средство для подготовки кожи, которое наносится после ухода за вашей кожей, чтобы создать идеальную основу для нанесения тонального крема, кремов BB / CC или консилера поверх.

Хорошая грунтовка поможет макияжу держаться дольше и в то же время устранит некоторые проблемы с кожей.

Как?

Некоторые праймеры предназначены для усиления увлажнения для более сухих типов кожи.

Праймеры для заполнения пор обычно основаны на силиконе (с использованием диметикона) и работают для минимизации пор и сглаживания поверхности кожи.

Матирующие праймеры под макияж предназначены для контроля жирности и сияния жирной кожи.

Некоторые праймеры делают некоторые из этих вещей одновременно, есть масса вариантов на выбор, чтобы дать вам безупречный цвет лица.

Как наносить праймеры в целом

Праймеры лучше всего наносить кончиками пальцев и всегда наносить после того, как был нанесен весь уход за кожей, и до нанесения макияжа .

Какой бы тип грунтовки вы ни использовали, всегда наносите ее тонкими слоями и при необходимости добавляйте больше.

Некоторые праймеры необходимо наносить более плотно в зависимости от типа кожи, в то время как другие можно наносить более экономно, поэтому может потребоваться метод проб и ошибок!

Как я наношу праймер Pore Filling Primer

Мое прозрение по поводу нанесения праймера произошло в прошлом году, когда я решил, что у меня есть несколько праймеров в моей коллекции, которые действительно нужно использовать или выбросить.

Мой туалетный столик для макияжа довольно миниатюрный, поэтому лишние продукты занимают место, которое можно было бы использовать для моих наиболее часто используемых предметов.

Решив еще раз попробовать наполнители пор и разглаживающие средства, я подумал, что немного поэкспериментирую … вместо того, чтобы втирать праймер в кожу, как обычно, я решил использовать немного больше праймера, но осторожно похлопал и нанёс праймер на кожу. области, где у меня большие поры.

Небольшое изменение, но важное: я понял, что моя неприязнь к наполнителям пор на мне, потому что все это время я неправильно их применяла!

После того, как я применил метод нежных похлопываний и толканий, мои праймеры стали работать намного лучше и довольно хорошо размыли мои недостатки.

ПО ТЕМЕ: 5 причин для нанесения пудры на основу

Почему это работает

Когда вы чрезмерно массируете праймеры, заполняющие поры, на лице, вы фактически уменьшаете количество нанесенного праймера, делая он менее эффективен для разглаживания и наполнения.

Вместо этого, осторожно похлопывая / нанося праймер на участки, которые необходимо сгладить, вы создаете тонкий слой праймера, который ложится поверх кожи и заполняет все недостатки под ней — просто обязательно сгладьте края. грунтовки; вы хотите, чтобы он плавно ложился на кожу и не выглядел заметным или тяжелым.

Нужен пример?

Подумайте о том, чтобы утром намазать тосты маслом; если вы намазываете небольшое количество масла на весь тост, на поверхности остается меньше масла, и большая его часть просачивается в отверстия и не всегда заполняет их полностью.

Однако, нанесите немного более толстый слой и осторожно Намазывая тост маслом, сверху остается слой масла, заполняющий все отверстия.

СВЯЗАННАЯ ЧТЕНИЕ: NYX Pore Filler Primer

Магазинные грунтовки для заполнения пор!

приколите меня на потом!

Как наносить праймеры, заполняющие поры и разглаживающие кожу?

15 Преимущества использования праймера для макияжа перед нанесением макияжа…

15 преимуществ использования праймера для макияжа перед нанесением макияжа … Поделиться

Возможно, вы уже были у стойки красоты и видели праймер для макияжа, но на самом деле не знаете обо всех преимуществах праймера для макияжа. В таком случае, скорее всего, вы не захотите доплачивать за товар, который, по вашему мнению, вам не нужен. Честно говоря, пока я не работала в Estee Lauder, я тоже. Потом я получила бесплатный образец праймера для макияжа, и меня зацепило. Недавно я перестал его использовать и действительно могу сказать разницу в своей коже, что заставило меня снова покупать его.Праймер для макияжа — это то, без чего я больше не буду обходиться, и если вам интересно, действительно ли есть какие-то преимущества в использовании праймера для макияжа, я хотел бы просветить вас: они есть! Вот мои самые популярные причины использовать его, а также рекомендации по конкретным продуктам.

Содержание:

  1. Запечатывает поры
  2. Смягчает кожу
  3. Разглаживает макияж
  4. Не вызывает комедонов
  5. Антивозрастной
  6. Макияж остается дольше
  7. Легкость
  8. 903 Легко наносится
  9. 903 Легко наносится
  10. Уменьшение появления прыщей
  11. Любой тип и цвет кожи
  12. Estee Lauder Idealist
  13. Estee Lauder Illuminating Perfecting Primer
  14. BareMinerals Prime Time
  15. Ulta Fabulous Face Foundation Primer

1 из 9 основных преимуществ праймер для макияжа закрывает поры.У меня никогда не было больших пор, но если вы выберете жидкую основу, вы уже знаете, что какими бы маленькими ни были ваши поры, жидкая основа может сделать их более заметными. Праймер для макияжа позаботится обо всем этом, запечатывая поры и создавая над ними почти одеяло.

63 Добавить комментарий …

2 Смягчает кожу

Еще одна причина, по которой я люблю праймер для макияжа, — это то, как он смягчает вашу кожу. Кажется, что он становится бархатистым, что усиливает эффект гладкости вашего макияжа.

37 Добавить комментарий …

3 Более гладкий макияж

Пока мы говорим о том, насколько гладким он делает ваш макияж, это еще одно преимущество само по себе. Использование праймера для макияжа перед нанесением макияжа сделает все ваше лицо похожим на бархат. Это действительно такой заманчивый вид, что трудно обойтись без него после того, как вы к нему привыкнете.

58 Добавить комментарий …

4 Некомедогенные

Большинство праймеров под макияж (хотя и не все) не вызывают комедонов, что означает, что они не повредят ваше лицо и не вызовут раздражения на коже.По этой же причине они совсем не забивают поры, поэтому не беспокойтесь, если ваша кожа склонна к закупорке пор или прыщам.

35 Добавить комментарий …

5 Антивозрастные

Большинство праймеров под макияж не обладают антивозрастными свойствами, хотя некоторые из них могут содержать антивозрастные ингредиенты. Однако они делают вашу кожу намного более молодой, поскольку сглаживают мелкие морщинки. Это создает более молодой вид и уменьшает видимость тонких линий и морщин.

50 Добавить комментарий …

6 Макияж держится дольше

Основная причина использования праймера заключается в том, что он помогает макияжу держаться дольше. Праймеры помогают уменьшить потоотделение через поры, что продлевает стойкость макияжа. Они также действуют как естественный щит от пыли, воды и мусора, которые могут стереть макияж.

94 Добавить комментарий …

7 Легкий вес

Если вы беспокоитесь о том, что праймер под макияж заставит вас чувствовать, что на вас маска, не делайте этого! Они придают коже приятный, мягкий вид, почти как бархатистый супермягкий лосьон.Честно говоря, с праймером под макияж моя кожа кажется светлее и красивее, чем без нее.

18 Добавить комментарий …

8 Легко наносится

Еще одна причина использовать праймер для макияжа — их невероятно легко наносить. Они действуют почти так же, как лосьон на вашем лице, но они намного легче и совсем не жирные. Они остаются жидкими, а затем быстро высыхают. Не волнуйтесь, это не что иное, как клей для лица или что-то в этом роде. Вместо этого они ощущаются как мягкое облако мягкости, почти как экзотическое лакомство.

58 Добавить комментарий …

9 Уменьшить покраснение

Еще одно преимущество использования праймеров для макияжа — они уменьшают покраснение и не вызывают раздражения на коже. По правде говоря, я надеюсь, что вы решите попробовать их, если у вас есть проблемы с покраснением, поскольку они, кажется, значительно помогают.

75 Добавить комментарий …

10 Уменьшает появление прыщей

Если вы страдаете от прыщей, грунтовки под макияж могут помочь уменьшить внешний вид. Хотя они не помогают бороться с прыщами, они помогают скрыть их лучше и тоньше, чем консилер, хотя я бы посоветовал использовать их после нанесения праймера.

37 Добавить комментарий …

11 Любой тип или цвет кожи

Абсолютно лучшее в использовании праймера для макияжа — это то, что они работают с любым типом кожи, а также с любым цветом кожи. Нет никаких оттенков на выбор, поэтому выбирать очень просто. Если вы хотите узнать, какие марки грунтовки лучше всего использовать, читайте мои любимые.

40 Добавить комментарий …

12 Estee Lauder Idealist

Хотя технически это не обозначено как грунтовка, на самом деле это так. Это был первый праймер, с которым я познакомился до того, как Estee Lauder выпустила свой собственный праймер.«Идеалист — продукт мечты каждой женщины. Действительно, он такой дорогой, но при этом делает вашу кожу бархатистой. Он также питает кожу, освещает кожу, придавая ей естественное сияние, и сохраняет невесомость. Он также защищает, полирует и придает молодость. Это роскошный продукт, но я определенно рекомендую попробовать, если вы можете себе это позволить. Вы можете получить 1,7 унции за 60 долларов в Estee Lauder.

41 Добавить комментарий …

13 Estee Lauder Illuminating Perfecting Primer

Еще один замечательный продукт от Estee Lauder — их официальный праймер для макияжа, который недавно появился на рынке.Он работает так же, как и «Идеалист», описанный выше, и, честно говоря, я не могу сказать слишком большой разницы между ними. Однако он более доступен по цене, поэтому стоит попробовать, если у вас мало денег на грунтовку, но вы хотите выбрать из высококачественного бренда. Одна унция стоит всего 34 доллара.

71 Добавить комментарий …

14 BareMinerals Prime Time

Это гораздо более доступный продукт, и он отлично подходит, если вы не так беспокоитесь о старении и тонких линиях и вам просто нужна базовая грунтовка. Хотя он помогает скрыть тонкие морщинки и разглаживает кожу, он не содержит специфических антивозрастных питательных веществ, подобных вышеперечисленным продуктам.Однако он очень прост в использовании, работает как мечта и не раздражает вашу кожу. Кроме того, это продукт на минеральной основе от одной из лучших компаний по производству минеральной косметики, что делает его продуктом высшего качества, который стоит попробовать. Вы можете найти его на bareMinerals, Ulta и Sephora.

4 Добавить комментарий …

15 Ulta Fabulous Face Foundation Primer

Если у вас действительно ограниченный бюджет, как у меня, это ваш выбор для начинающих! Мне нравятся продукты Ulta, и их праймер для макияжа определенно стоит попробовать, если вам нужен отличный праймер по доступной цене.Он имеет те же преимущества, что и другие праймеры, но не содержит специальных антивозрастных ингредиентов. Мне лично он нравится, и если вы хотите попробовать грунтовку, но никогда не использовали ее, обязательно попробуйте. Это определенно стоит небольших денег и прослужит долго. Найдите свой за 12,50 долларов в Ulta.

Чтобы нанести праймер, просто примите душ или умойтесь, как обычно, перед нанесением макияжа. Вытрите лицо, нанесите праймер размером примерно с десять центов, а затем просто дайте ему высохнуть в течение 3-5 минут.Обычно я закручиваю волосы в бигуди или выпрямляю их после нанесения праймера, а когда я закончу, я готова нанести тональный крем и продолжить процедуру макияжа. Если вы используете праймер для макияжа, какой у вас любимый бренд? Или, если вы никогда не использовали праймер для макияжа, не могли бы вы попробовать его сейчас?

24 Поделиться

Оцените, пожалуйста, эту статью

☆☆☆☆☆

Подробнее


Комментарии

Популярные

Недавние

Как наносить грунтовку | Как подготовить дерево к морилке

Вне зависимости от того, выдерживает ли ваш дом ледяные зимы Новой Англии, бесконечные снегопады Среднего Запада или снежные бури на Аляске, важно защитить древесину за пределами вашего дома.Если у вас деревянный сайдинг, настил или деревянные панели, вы должны предпринять несколько жизненно важных шагов, прежде чем погода изменится к худшему.

В зависимости от уровня непрозрачности, степени защиты от ультрафиолета и долговечности каждого покрытия Storm System упростила выбор наиболее подходящей морилки для древесины. Мы используем знакомую цветовую кодировку погоды и такие фразы, как «Легкая» или «Сильная», чтобы описать условия, наиболее подходящие для каждого продукта.

Базирующаяся в Новой Англии (Андовер, Массачусетс), Storm System действительно понимает, насколько важны грунтовки и твердые пятна для настила и сайдинга зимой, поэтому ниже вы найдете несколько полезных советов по нанесению грунтовки и твердых пятен.

ПРАЙМЕРЫ

Как вы, возможно, знаете, грунтовки — это подготовительные покрытия, которые следует использовать перед окраской или окрашиванием сплошным цветом. Будь то дерево, металл или пластик, грунтовки увеличивают стойкость краски или морилки и обеспечивают лучшее сцепление с поверхностью. Важно отметить, что грунтовки не являются необходимостью для обработки морилкой, особенно когда желаемая отделка должна показать фактическую структуру древесины.

Storm System состоит из двух грунтовок для дерева: акриловой латексной грунтовки и быстросохнущей масляной грунтовки.Независимо от того, находится ли поверхность, которую необходимо обработать, в чрезвычайно выветрившемся, поврежденном состоянии или если поверхность будет подвергаться воздействию экстремальных погодных условий или интенсивного движения и износа, не ищите ничего, кроме этих двух грунтовок. В зависимости от суровости надвигающейся погоды вам понадобится твердое или полутвердое пятно, чтобы завершить работу и сохранить профессиональный вид на долгие годы.

ТВЕРДАЯ ПЯТНА

Как мы упоминали выше, после того, как вы нанесли грунтовку на внешнее дерево, лучший способ обеспечить «хорошо выполненную работу» — использовать твердую морилку.Твердые пятна придают дереву совершенно непрозрачный вид, напоминающий краску. Storm System предлагает два твердых красителя: акриловый краситель с технологией Enduradeck и 100% акриловый краситель. Acrylic Stain разработан для обеспечения матовой отделки горизонтальных поверхностей, таких как отделка и сайдинг, в то время как Acrylic Stain с технологией Enduradeck заставляет поверхности казаться ровными при прямом взгляде и мягким блеском при просмотре под углом, идеально подходящим для дерева, которое подвергнется значительному износу из-за дорожного движения или погодных условий.

Зачем нужен праймер для лица? Часто задаваемые вопросы о праймерах

Зачем использовать праймер для лица? Часто задаваемые вопросы по грунтовке | Smashbox стрелка — значок вниз стрелка — значок вверх thin — правая iconcaret-тонкая-белая — левая iconcaret-тонкая-белая — правая iconcaret-with-bg — левая iconcaret-with-bg — правая iconcaret-with-bg-semi-opaque — левая iconcaret- with-bg-semi-opaque — правый iconcaret-with-bg-semi-opaque-white — левый iconcaret-with-bg-semi-opaque-white — правый iconcaret-with-bg-white — левый iconcaret- with-bg-white — правая иконка иконка тележки значок xclose iconemail значокfacebook значокгамбургер значок заголовок — контурный значок — сплошной значок сердце — выбранный значок значок сердцаinstagram значокlivechat-контур значокlivechat значок расположение — заполненный значок расположение-значок поиска значок значоклоготип значоккарта-маркер значок минус — жирный значок минус значок значок телефона интерес — значок круга значок треугольник-правый значок треугольник-вверх значок icontwitter кнопка воспроизведения видео — черный значок кнопка воспроизведения видео — белый значок значок воспроизведения видео vk значокx-нижний значокx-верхний значокxo значокyoutube — значок воспроизведения значок YouTube {{/ изображение }} {{# заглавие }} {{/ заглавие }} {{# описание }}

{{{ описание }}}

{{/ описание }} {{# link_text}} {{/ link_text}} {{# title}}

{{{title}}}

{{/ title}} {{# описание }}

{{{ описание }}}

{{/ описание }} {{# link_text}} {{/ link_text}} .
Posted in Разное

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *